Effect of primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of conjugated dyes

Abstract

We studied fluorescence intensity, polarization and lifetime of some commonly used fluorophores conjugated to oligodeoxyribonucleotides with different primary and secondary structures. We found that fluorescence intensity can increase or decrease upon hybridization of the labeled strand to its complement depending on the sequence and position of the fluorophore. Up to 10-fold quenching of the fluorescence upon hybridization was observed when the dye moiety was attached close to the 3' end and the 3'-terminal base was either dG or dC. No quenching upon hybridization was observed when the dye was positioned within the same sequence context but close to the 5' end. The presence of a dG overhang quenches the fluorescence less efficiently than a blunt end dG-dC or dC-dG base pair. When located internally in the double strand, the dG-dC base pair does not affect the fluorescence of the nearby dye. Guanosine in a single-stranded oligonucleotide quenches the fluorescence of nearby dye by <2-fold. Upon duplex formation, this quenching is eliminated and the fluorescence increases. This increase can only be detected when the fluorophore is located at least 6 nt from the terminal dG-dC base pair. The change of fluorescence polarization upon duplex formation inversely correlates with the change of intensity. Fluorescein conjugated to a single-stranded oligonucleotide or a duplex undergoes a bi-exponential decay with approximately 4 and approximately 1 ns lifetimes.

Figure 1

Melting curves of oligodeoxynucleotide duplexes labeled with fluorescein. (A) d(CCTTCTCATGGTGGCTGTAG) and (B) d(CCTTCTCATGGTGGCTGTAGAACT) were hybridized to an excess of the complementary oligonucleotide of the same size and melting curves were measured as described in the Materials and Methods. The labeling positions are shown in bold.

Figure 2

Change of the fluorescence intensity upon hybridization of oligodeoxynucleotides labeled with FAM at the 5′ end, 3′ end or internally. The internal labeling positions are shown in bold. The complementary strand is shown in lower case. The ratio between the fluorescence of the double-stranded and single-stranded labeled oligonucleotides was determined as described in the Materials and Methods.