Identification of the single base change causing the callipyge muscle hypertrophy phenotype, the only known example of polar overdominance in mammals

Abstract

A small genetic region near the telomere of ovine chromosome 18 was previously shown to carry the mutation causing the callipyge muscle hypertrophy phenotype in sheep. Expression of this phenotype is the only known case in mammals of paternal polar overdominance gene action. A region surrounding two positional candidate genes was sequenced in animals of known genotype. Mutation detection focused on an inbred ram of callipyge phenotype postulated to have inherited chromosome segments identical-by-descent with exception of the mutated position. In support of this hypothesis, this inbred ram was homozygous over 210 Kb of sequence, except for a single heterozygous base position. This single polymorphism was genotyped in multiple families segregating the callipyge locus (CLPG), providing 100% concordance with animals of known CLPG genotype, and was unique to descendants of the founder animal. The mutation lies in a region of high homology among mouse, sheep, cattle, and humans, but not in any previously identified expressed transcript. A substantial open reading frame exists in the sheep sequence surrounding the mutation, although this frame is not conserved among species. Initial functional analysis indicates sequence encompassing the mutation is part of a novel transcript expressed in sheep fetal muscle we have named CLPG1.

Figure 1

Marker informativeness among heterozygous (by progeny testing) CLPG Dorset rams used in the mutation discovery panel. Asterisks on the top row (Map) indicate relative positions of markers used to construct the chromosome 18 linkage group. The arrow (position 86–87 cM) indicates relative position of the CLPG locus. Markers heterozygous are presented as asterisks for each ram. All rams were genotyped for all markers on the chromosome 18 map. Regions of the linkage group for each ram not flanked by an informative marker are indicated by dotted lines. Of particular interest, rams 198812900 and 199112900 exhibit marker homozygosity in the critical region containing CLPG.

Figure 2

Ram 198812900 exhibits an inbreeding path with the sire (S318167) of Solid Gold contributing on both maternal and paternal sides of the pedigree. We hypothesized that this inbreeding path has allowed the region to be identical-by-descent, except for the CLPG mutation, which we propose occurred in the gamete that produced Solid Gold. The C identifies the mutated allele, and individuals with the muscle hypertrophy phenotype are identified as solid black sheep; those with normal phenotype are identified as gray sheep. Wild-type chromosomes are represented as gray chromatids. A recombination event is depicted to have occurred on the maternal side of the pedigree; however, the event could have occurred on either or both sides to generate marker informativeness in the centromeric region of chromosome 18.

Figure 3

Identification of the causal base change (SNP) for CLPG. (A) Position of the identified SNP relative to previously identified candidate genes (DLK1, DAT, MEG3, and PEG11). Microsatellite marker OY3 was the previously defined telomeric boundary. Scale is set to 1 = 1000 bp of the sheep genomic sequence in GenBank accession AF354168. The SNP is at position 267 of the sheep STS sequence in accession AF401294. (B) Sequence traces representing the different genotypes present at the noted SNP. A Romanov ewe (NN at CLPG) displays the homozygous adenine residue, while the progeny-tested composite ram (CC at CLPG) displays the homozygous guanine residue. The inbred ram 198812900 (CN at CLPG) exhibits both residues at this position. (C) Results from a MALDI-TOF mass spectrometry genotyping assay for this SNP. The two alleles are represented as different mass extension products from a probe primer with the 3′ end adjacent to the SNP (Table 2). Probe extension in the presence of a specific di-deoxy termination mix creates the different analyte masses for each allele.

Figure 4

Alignment of 144 bp of sheep genomic sequence flanking the identified SNP with homologous cattle, human, and mouse genomic sequence. The SNP is identified with the arrow. Percentage homology with the sheep sequence ranged from 99.3% identical (cattle) to 78.4% identical (mouse). The 10-bp motif for a MyoD recognition site is underlined. Primers used for RT-PCR experiments are double underlined.

Figure 5

Functional analysis of the region that encompasses the CLPG mutation. (A) An electrophoretic mobility shift assay using MyoD/E47 proteins and radiolabeled oligonucleotide probes representing the CLPG region. Probes were incubated either with no protein (Cont), 1 μL in vitro translated MyoD/E47, or 5 μL MyoD/E47, and the resulting complexes (B) were separated from free probe (F) by electrophoresis. MyoD/E47 forms two complexes with target DNA elements: the upper complex contains full-length proteins, and the lower complex contains a smaller translation product of E47 (Lemercier et al. 1998). (B) Expression of a transcript containing the CLPG mutation. RNA from fetal longissimus muscle was reverse transcribed with primer 21911 (primer sequence in Fig. 4) (lane 1) or 22051 5′- GCAAGGGTCTGTTTGGTCCTAA - 3′ (lane 2). Resulting cDNA was amplified with primer 21911 and a nested reverse primer, 22052 5′- GCTGGAGACGTGCAGCTCTAA - 3′. Control PCR with these primers utilized RNA from a mock reverse transcription to rule out DNA contamination (lane 3), no template negative control (lane 4), or ovine genomic DNA (lane 5).