Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus

Abstract

Background: An available whole genome sequence for Aspergillus flavus provides the opportunity to characterize factors involved in pathogenicity and to elucidate the regulatory networks involved in aflatoxin biosynthesis. Functional analysis of genes within the genome is greatly facilitated by the ability to disrupt or mis-express target genes and then evaluate their result on the phenotype of the fungus. Large-scale functional analysis requires an efficient genetic transformation system and the ability to readily select transformants with altered expression, and usually requires generation of double (or multi) gene deletion strains or the use of prototrophic strains. However, dominant selectable markers, an efficient transformation system and an efficient screening system for transformants in A. flavus are absent.

Results: The efficiency of the genetic transformation system for A. flavus based on uracil auxotrophy was improved. In addition, A. flavus was shown to be sensitive to the antibiotic, phleomycin. Transformation of A. flavus with the ble gene for resistance to phleomycin resulted in stable transformants when selected on 100 mug/ml phleomycin. We also compared the phleomycin system with one based on complementation for uracil auxotrophy which was confirmed by uracil and 5-fluoroorotic acid selection and via transformation with the pyr4 gene from Neurospora crassa and pyrG gene from A. nidulans in A. flavus NRRL 3357. A transformation protocol using pyr4 as a selectable marker resulted in site specific disruption of a target gene. A rapid and convenient colony PCR method for screening genetically altered transformants was also developed in this study.

Conclusion: We employed phleomycin resistance as a new positive selectable marker for genetic transformation of A. flavus. The experiments outlined herein constitute the first report of the use of the antibiotic phleomycin for transformation of A. flavus. Further, we demonstrated that this transformation protocol could be used for directed gene disruption in A. flavus. The significance of this is twofold. First, it allows strains to be transformed without having to generate an auxotrophic mutation, which is time consuming and may result in undesirable mutations. Second, this protocol allows for double gene knockouts when used in conjunction with existing strains with auxotrophic mutations. To further facilitate functional analysis in this strain we developed a colony PCR-based method that is a rapid and convenient method for screening genetically altered transformants. This work will be of interest to those working on molecular biology of aflatoxin metabolism in A. flavus, especially for functional analysis using gene deletion and gene expression.

Figure 1

Transformants of A. flavus 3357 with pBC-phleo. Twice as many colonies were observed when transformants were plated on MLS plus 50 μg/ml of phleomycin (left 2 plates) versus 100 μg/ml of phleomycin (right 2 plates). The two plates lacking growth of the fungus are negative controls for untransformed A. flavus 3357 under the selection of phleomycin at 50 μg/ml (left) or 100 μg/ml (right).

Figure 2

Southern blot analysis showing the presence of the pBC-phleo vector in two transformants of Aspergillus flavus. Lanes 1 and 5: strain 3357-5; lanes 2 and 6: strain 3357-5 transformed with a pBC-phleo alcA::rasA construct: Lanes 3 and 7: strain 3357-5 ΔrdiA complemented with the pBC-phleo vector containing rdiA. Lane 4: Blank. DNA in lanes 1–3 digested with BamH I and DNA in lanes 5–7 digested with Kpn I. Southern hybridization was performed using a probe amplified from plasmid pBC-phleo with the following primer pairs: BleF, 5'CCCGCTTGAGCAGACATC3' and BleR, 5'TCGTCCTGACTGGCTGCG3'.

Figure 3

Visualization of aflatoxin production in strain 3357 and the generated pyrG mutants of 3357 by thin layer chromatography (TLC). B1: standard for aflatoxin B1 (Sigma). B2: standard for aflatoxin B2 (Sigma). Lanes labeled #1-#8 represent pyrG mutants. 3357: original A. flavus strain.

Figure 4

Growth comparison of A. flavus 3357 and pyrG mutant 3357-5 on either PDA, PDAU or PDAUU. U: uracil; UU: uracil plus uradine.

Figure 5

Overlap PCR construct for transformation of A. flavus and the location of primers for identifying transformants using PCR-based screen. Primers P2, P3, P4, and P5 consist of two parts, one part is homologous to the putative superoxide dismutase (P-SOD) gene (GenBank accession no: CA747446) and another part is homologous to selection marker pyr4.

Figure 6

Colony PCR products for identifying uracil-independent transformants using genomic DNA extracted by CTAB method and primer pairs P1 and P6. Lane 1: The control native target sequence which PCR-amplified from 3357-5; Lane 3–20: From different transformant colonies.

Figure 7

PCR-amplification of 2 uracil-independent transformants SOD#5 and SOD#30 using different primer pairs to confirm if the transformation construct replaced the target sequence. Lane 2–4: template DNA from transformant SOD#5 (Lane 3 in Figure 6), Lane 5–7: template DNA from transformant SOD#30 (lane 12 in Figure 6). Primer pairs used as: P1 and P6 were used on lane 2 and 5, band size is 3385 bp; Primers P0 and P6 were used on lane 3 and 6, band size is 3385 + 101 = 3486 bp; Primers P0 and P5 were used on lane 4 and 7, band size is 3385 + 101 -- 1005 = 2481 bp.

Figure 8

Southern blot analysis of two A. flavus transformants SOD#5 and SOD#30 after deletion of a putative superoxide gene (GenBank No: CA747446) using an overlap PCR technique with pyr4 as a selectable marker. (A) Genomic DNA digested with Kpn I or BamH I and run on an 0.8% agrose gel. (B) Southern hybridization using N. crassa pyr4 as a probe amplified from plasmid pBSK-pyr4 with the following primer pairs: Pyr-F, 5' TTGGACCACACGAGTCAAG 3' and Pyr4-R, 5' GAAAACGAAATATCCTCCGCC 3'. Lanes 1 & 5 are SOD#5; Lanes 2 & 6 are SOD#30; Lanes 3 & 7 are 3357-5; Lane 4 is blank. Lanes 1–3 digested with Kpn I; Lanes 5–7 digested with BamH I. The two bands in lane 2 suggest multiple integrations in SOD#30.