Zasp is required for the assembly of functional integrin adhesion sites

Abstract

The integrin family of heterodimeric transmembrane receptors mediates cell-matrix adhesion. Integrins often localize in highly organized structures, such as focal adhesions in tissue culture and myotendinous junctions in muscles. Our RNA interference screen for genes that prevent integrin-dependent cell spreading identifies Z band alternatively spliced PDZ-motif protein (zasp), encoding the only known Drosophila melanogaster Alp/Enigma PDZ-LIM domain protein. Zasp localizes to integrin adhesion sites and its depletion disrupts integrin adhesion sites. In tissues, Zasp colocalizes with betaPS integrin in myotendinous junctions and with alpha-actinin in muscle Z lines. Zasp also physically interacts with alpha-actinin. Fly larvae lacking Zasp do not form Z lines and fail to recruit alpha-actinin to the Z line. At the myotendinous junction, muscles detach in zasp mutants with the onset of contractility. Finally, Zasp interacts genetically with integrins, showing that it regulates integrin function. Our observations point to an important function for Zasp in the assembly of integrin adhesion sites both in cell culture and in tissues.

Figure 1.

D. melanogaster S2R+ cells exhibit integrin adhesion sites. Integrins cluster in adhesion sites in S2R+ cells. (A–F) Anti–βPS integrin antibody staining of S2R+ (A) and S2 (B) cells spread on concanavalin A. βPS integrin localizes to bright foci and streaks at the cell edge of S2R+ cells. We observed similar clustering with anti–C. elegans vinculin antibody staining (C) and anti-talin antibody staining (E) in S2R+ but not in S2 cells (D and F). (G–I) Colocalization of anti–C. elegans vinculin (G) and anti–αPS2 integrin (H) antibody staining at the cell edge of S2R+ cells. Merge is shown in I. (J–L) Colocalization of anti-talin (J) and anti–βPS integrin (K) antibody staining. Merge is shown in L. Indicated areas are shown enlarged on the right. Bar, 15 μm.

Figure 2.

Zasp is required for integrin-dependent spreading of S2R+ cells. (A–F) S2R+ cells spreading without addition of external ligand (A–C) and S2 cells spreading on concanavalin A (D–F). A and D, no RNAi treatment; B and E, treatment with Abi RNAi; C and F, treatment with rhea (talin) RNAi. Cells were stained with Alexa 594–phalloidin for filamentous actin. Abi-depleted cells show star-shaped phenotypes in both cell lines (B and E), whereas talin depletion results in rounding up only in S2R+ cells (C). (G) Schematic presentation of the zasp gene. Translated exons are shown in gray and untranslated exons in white. piggyBac insertions used to generate the zasp^Δ deletion and dsRNAs used to target the zasp gene are indicated. Only the two major splice variants are shown. (H) The D. melanogaster zasp gene encodes two major proteins. Zasp^Enigma is the Enigma-like protein and Zasp^Alp is the Alp-like protein. Numbers represent the amino acid length of each protein. Below three conserved domains, we show the percent identity between Zasp and its human orthologue. (I and J) zasp exon 5 RNAi targeting zasp-RA and zasp-RB. Cells are stained with Alexa 594–phalloidin to visualize the actin cytoskeleton. (I) S2R+ cells round up and exhibit many filopodia-like processes. (J) S2 cells spread on concanavalin A show no phenotype. (K) RT-PCR analysis of zasp dsRNA-treated cells compared with untreated ones. zasp mRNA (153 bp exon 5 amplicon) is depleted in both S2R+ and S2 cells. Control PCR was done with primers against an untargeted gene. Bars, 15 μm.

Figure 3.

Zasp localizes to integrin adhesion sites and Zasp depletion disrupts integrin adhesion sites. (A–C) Anti–βPS integrin antibody (green) and Alexa 594–phalloidin (red) costaining of wild-type S2R+ cells or cells treated with zasp exony 7 dsRNA (B and C). Typically, integrin adhesion sites are very small or absent (B). In milder cases, integrin adhesion sites are reduced in number and the cell retracts its edge between two integrin adhesion sites (C). (D–I) Anti–βPS integrin antibody (green) and anti-Zasp antibody (red) coimmunostaining of S2R+ (D–F) and S2 (G–I) cells spread on concanavalin A. Zasp colocalizes with βPS integrin in foci and streaks in S2R+ cells (D–F). Bar, 15 μm.

Figure 4.

Zasp protein and mRNA expression patterns overlap during embryogenesis. RNA in situ hybridization with zasp full-length antisense mRNA (left) and anti-Zasp (right) antibody staining. (A) A low level of zasp mRNA, likely the maternal contribution, is visible in preblastoderm-stage embryos. (B) Zasp protein is also detected in a preblastoderm-stage embryo. (C and D) Zygotic mRNA and protein expression is first detected in the proctodeum (pr) and the midgut primordium (pm). (E and F) In stage-11 embryos, zasp mRNA and Zasp protein expression is predominant in the leading edge (le) of epidermal cells adjacent to the amnioserosa (as). (G) Dorsal view of a stage-12 embryo reveals mRNA localization in the midgut (mg) and in the leading edge. (H) Zasp protein is expressed in several rows of germ band cells next to the leading edge at stage 14. (I) Strong mRNA expression is visible in the midgut and pharyngeal muscles (phm) in a dorsal view of a stage-17 embryo. (J) Zasp protein expression is additionally visible in somatic muscles (sm) and visceral mesoderm (vm). Bars, 50 μm.

Figure 5.

Zasp colocalizes with integrins at myotendinous junctions during embryonic development and with α-actinin at muscle Z lines. (A–C) Anti-Zasp antibody staining (A), anti–βPS integrin antibody staining (B), and merge of a stage-16 embryo (C). Zasp and βPS integrin colocalize at myotendinous junctions. Indicated areas are shown enlarged in A′–C′. (D–F) Anti-Zasp antibody staining (D), anti–βPS integrin antibody staining (E), and merge (F) of a first-instar larva. Note the slightly wider gap of Zasp staining compared with that of βPS integrin staining at the myotendinous junction. (G–I) Anti-Zasp antibody staining (G), anti–α-actinin antibody staining (H), and merge (I) of a first-instar larva. Note the tight colocalization of Zasp and α-actinin at myotendinous junctions and Z lines. (J–L) Anti-Zasp antibody staining (J), anti–α-actinin antibody staining (K), and merge (L) of a zygotic mys^XG43 mutant embryo. Zasp and α-actinin no longer localize at the termini of detached muscles (J, arrow). Asterisks indicate myotendinous junctions. Arrowheads indicate Z lines. Bar, 50 μm.

Figure 6.

zasp mutant embryos die as first-instar larvae. (A) Putative deletion lines were screened for the presence of residual piggyBac elements by means of PCR, using transposon-specific primers (RB(WH+) reverse and forward) in combination with genome-specific primers (exon 3 forward and 9 reverse). Amplification of both PCR products indicates the presence of both residual piggyBac elements and therefore a recombination and deletion event. Genomic DNA extracted from control flies (C, pBac{WH}f04847) is only amplified with the e3forward/RBreverse primers. 1- and 2-kb size markers are indicated. (B) Absence of zasp mRNA in two deletion lines was verified by RT-PCR using primers CACCATGGCCCAACCACAGCTGCTG and GCGCGCGTGATTCTTGCAG. Amplification of a 2.1-kb band (asterisk) is detected only in wild-type embryos (wt). (C and D) RNA in situ hybridization with a full-length antisense probe demonstrates absence of zasp mRNA in zasp^Δ mutant embryos (D). (E and F) Anti-Zasp antibody staining reveals no obvious Zasp protein in zasp^Δ mutant embryos (F). (G) Stage of death of zasp^Δ mutants. (H) Developmental stage of zasp^Δ mutant larvae was determined by the number of teeth on the mouth hooks, which increase with instar. Mouth hooks of zasp^Δ9 mutant larvae (iv) look like those of first-instar wild-type larvae (i). Bar, 50 μm.

Figure 7.

zasp^Δ mutants develop no striated muscles and Z lines. (A) Late–stage 17 wild-type embryo stained with phalloidin to visualize actin fibers. The striated muscle pattern, which indicates sarcomere differentiation, is clearly visible (arrowhead). A sarcomere extends from the center of one block of actin staining to the next. (B) Late–stage 17 zasp^Δ mutant embryo stained with phalloidin. No striation is evident. (C) Zasp physically interacts with α-actinin in larvae. Immunoprecipitation (IP) was conducted with preimmune serum or anti-Zasp antibody using wild-type and zasp^Δ9 mutant larvae. Detection was performed by Western blotting (WB) with anti– α-actinin antibody. Only immunoprecipitation with anti-Zasp antibody with wild-type larvae coprecipitates α-actinin. Molecular mass is indicated in kilodaltons. (D–G) Ultrastructural analysis of first-instar larval sarcomeres and Z lines by electron microscopy. (D) Newly hatched wild type. (E) 1-d-old first-instar Actn¹⁴ mutant. (F and G) Newly hatched zasp^Δ mutant. Black arrowheads indicate Z lines, Z line remnants, or electron-dense material. Bars: (A and B) 50 μm; (D–G) 1 μm.

Figure 8.

zasp^Δ mutants do not recruit α-actinin to Z lines. (A) Wild-type larva stained with anti-Zasp antibody (green) and anti–α-actinin antibody (red). (B) In zasp^Δ mutant larvae, α-actinin fails to localize to Z lines and instead appears to localize along the length of actin filaments. (C) Localization of endogenous GFP-Zasp (G00189) in fixed wild-type first-instar larva. (D) GFP-Zasp still localizes to Z lines in an Actn¹⁴-null mutant larva. (E and F) Anti–titin-KZ/anti–α-actinin coimmunostaining of wild-type (E) and Actn¹⁴ (F) mutant first-instar larva. Titin does not localize to Z lines in the Actn mutant. Bar, 50 μm.

Figure 9.

zasp^Δ mutants have muscle-attachment defects. Stage-17 embryos are stained with an antibody against muscle myosin heavy chain (MHC; green) to visualize somatic muscles and an antibody against βPS integrin (red) to visualize myotendinous junctions. (A) Wild-type embryo. (B) zasp^Δ mutant embryo with mild muscle detachment. (C) zasp^Δ mutant embryo with severe muscle detachment. (D) mys^XG43 mutant embryo shown for comparison. Indicated areas are shown enlarged in A′–D′. Arrows indicate detached muscles. Asterisks indicate myotendinous junctions. Bar, 50 μm.

Figure 10.

Zasp genetically interacts with integrins. To determine the stage at which muscle attachment fails, embryos were labeled with antibodies against muscle myosin heavy chain (MHC; green) and βPS integrin (red). Merge is shown in the left panels. The right panels show βPS integrin. (A and B) Stage-17 if^SEF embryo showing mild muscle detachment. (C and D) Stage-16 if^SEF embryo showing wild-type muscle organization. (E and F) Stage-16 if^SEF; zasp^Δ9/+ embryo showing severe muscle detachment. (G and H) Stage-17 if^SEF; f04784/+ embryos showing mild muscle detachment identical to if^SEF embryos. (I) Percentage of embryos showing muscle detachment. ND, not determined. Arrows indicate detached muscles. Asterisks indicate myotendinous junctions. Bar, 50 μm.