Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2008 Dec;21(4):477-82.
doi: 10.1089/vim.2008.0048.

HCMV IL-10 Suppresses Cytokine Expression in Monocytes Through Inhibition of Nuclear factor-kappaB

Affiliations
Free PMC article

HCMV IL-10 Suppresses Cytokine Expression in Monocytes Through Inhibition of Nuclear factor-kappaB

James Nachtwey et al. Viral Immunol. .
Free PMC article

Abstract

Modulation of host immune responses is a common strategy for promoting virus persistence and avoiding clearance. Human cytomegalovirus (HCMV) is known to encode numerous immunomodulatory genes, including a homolog of the cytokine human interleukin-10 (hIL-10). While having limited sequence homology to hIL-10, cytomegalovirus IL-10 (cmvIL-10) shares many functional characteristics with the human cytokine and acts as a potent suppressor of the inflammatory immune response. The mechanism by which hIL-10 inhibits inflammatory cytokines involves a transcriptional block via inhibition of nuclear factor-kappaB (NF-kappaB) activity. To determine whether cmvIL-10 employs the same mechanism to inhibit cytokine production, the effect of cmvIL-10 on NF-kappaB signaling in monocytes was investigated. The results demonstrate that cmvIL-10 does inhibit NF-kappaB activation, as evidenced by reduced degradation of the NF-kappaB inhibitor IkappaB-alpha, and decreased transcription of the NF-kappaB-responsive genes tumor necrosis factor-alpha (TNF-alpha) and IL-1beta. These studies confirm that cmvIL-10 mediates cytokine suppression by blocking NF-kappaB transcriptional activity in human monocytes.

Figures

FIG. 1.
FIG. 1.
cmvIL-10 prevents degradation of IκB-α. THP-1 cells were treated with purified recombinant cmvIL-10 (1, 20, or 100 ng/mL; R&D Systems, Minneapolis, MN) or hIL-10 (100 ng/mL; R&D Systems) for 1 h prior to stimulation with 10 ng/mL LPS (Sigma, St. Louis, MO). The total protein in each lysate was quantified using the Bio-Rad Protein Assay Kit (Hercules, CA), and 10 μg total protein was loaded into each well. The lysates were resolved by SDS-PAGE and analyzed by immunoblotting with polyclonal antiserum to either (A) total IκB-α or (B) phosphorylated IκB-α (phospho-IκB-α) (Cell Signaling Technologies, Danvers, MA). In each case, total Stat3 protein was detected via blotting with polyclonal antiserum to Stat3 (Cell Signaling Technologies) to ensure equal sample loading. When detecting phosphorylated IκB-α, cell treatments were performed in the presence of 20 mM lactacystin (Sigma) to inhibit proteasome-mediated degradation. Alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (Anaspec, San Jose, CA) and Western Blue Substrate (Promega, Madison, WI) were utilized for detection. The blots shown are representative of three independent experiments.
FIG. 2.
FIG. 2.
cmvIL-10 inhibits transcription of inflammatory cytokines. (A) THP-1 monocytes were treated with 100 ng/mL cmvIL-10 or hIL-10 prior to stimulation with 10 ng/mL LPS for 3 h. Total cellular RNA was isolated (RNEasy Midi Kit; Qiagen, Valencia, CA), reverse transcribed, and amplified with gene-specific primers. PCR conditions included an initial denaturation at 94°C for 1 min and then 30 cycles of 94, 60, and 72°C (30 sec each). PCR products were resolved by gel electrophoresis using a 2% agarose gel. The gel shown is representative of two independent experiments (SOCS 3, suppressor of cytokine signaling protein 3). (B) Real time quantitative PCR analysis was performed using prepared cDNA templates, gene-specific primers, and SYBR Green Buffer (BioRad, Hercules, CA) in a 20-μL reaction mixture. The forward and reverse primers were as follows: for β-actin: AAGAGAGGCATCCTCACCCT (f), TACATGGCTGGGGTGTTGAA (r); for TNF-α: AACCTCCTCTCTGCCATCAA (f), CCAAAGTAGACCTGCCCAGA (r); for IL-1β: TCCCCAGCCCTTTTGGA (f), TTAGAACCAAATGTGGCCGTG (r). The primers for SOCS 3 were obtained from Qiagen (QuantiTect Primer Assay). The Livak comparative 2−ΔC(t) method was used to calculate relative gene expression and measure fold differences in target nucleic acid between samples. The C(t) values of target genes TNF-α and IL-1β were normalized to the housekeeping gene β-actin and the ΔC(t)Average was calculated from three replicates, then expressed as a percentage of total LPS-induced levels of cytokine. Error bars represent standard error among replicates. These data are representative of three independent experiments.

Similar articles

See all similar articles

Cited by 20 articles

See all "Cited by" articles

Publication types

MeSH terms

Feedback