Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
, 83 (6), 2500-9

Discovery of a Novel Single-Stranded DNA Virus From a Sea Turtle Fibropapilloma by Using Viral Metagenomics

Affiliations

Discovery of a Novel Single-Stranded DNA Virus From a Sea Turtle Fibropapilloma by Using Viral Metagenomics

Terry Fei Fan Ng et al. J Virol.

Abstract

Viral metagenomics, consisting of viral particle purification and shotgun sequencing, is a powerful technique for discovering viruses associated with diseases with no definitive etiology, viruses that share limited homology with known viruses, or viruses that are not culturable. Here we used viral metagenomics to examine viruses associated with sea turtle fibropapillomatosis (FP), a debilitating neoplastic disease affecting sea turtles worldwide. By means of purifying and shotgun sequencing the viral community directly from the fibropapilloma of a Florida green sea turtle, a novel single-stranded DNA virus, sea turtle tornovirus 1 (STTV1), was discovered. The single-stranded, circular genome of STTV1 was approximately 1,800 nucleotides in length. STTV1 has only weak amino acid level identities (25%) to chicken anemia virus in short regions of its genome; hence, STTV1 may represent the first member of a novel virus family. A total of 35 healthy turtles and 27 turtles with FP were tested for STTV1 using PCR, and only 2 turtles severely afflicted with FP were positive. The affected turtles were systemically infected with STTV1, since STTV1 was found in blood and all major organs. STTV1 exists as a quasispecies, with several genome variants identified in the fibropapilloma of each positive turtle, suggesting rapid evolution of this virus. The STTV1 variants were identical over the majority of their genomes but contained a hypervariable region with extensive divergence. This study demonstrates the potential of viral metagenomics for discovering novel viruses directly from animal tissue, which can enhance our understanding of viral evolution and diversity.

Figures

FIG. 1.
FIG. 1.
Effectiveness of the virus purification procedure as determined by PCR assays. “Purified viral DNA,” as indicated by arrows, was extracted from viral particles purified by filtration, density-dependent centrifugation, and nuclease treatment. “Total FP DNA” was extracted from a sea turtle fibropapilloma without any purification of viruses. The amount of host and mitochondrial DNA was greatly reduced in the purified viral DNA, while STTV1 was enriched in this fraction.
FIG. 2.
FIG. 2.
Genome characteristics and organization of STTV1 variants. Variants STTV1-GA1 to -GA5 originated from a single green turtle. STTV1-GB1 to -GB4 originated from a second green turtle. CAV, TTV, and PCV-2 are included for comparison of genome organization. Genome annotation is based on sequence data only, since there are no transcriptional data available for STTV1. CAV, TTV, and PCV-2 genome organization has been redrawn based on GenBank annotation and as depicted in the work of Todd (63). Note the similarity in genome organization between STTV1, CAV, and TTV, which is distinct from the two large opposite ORFs of PCV-2.
FIG. 3.
FIG. 3.
(a) Alignment of the nine HVR sequences. The variants STTV1-GA1 to STTV1-GA5 originated from a single green turtle, while STTV1-GB1 to STTV1-GB4 originated from a second turtle. Primer STTV1-B Forward (5′ CAAGCACCTTCCCAATACGGC 3′) is underlined. Part of STTV1-B Reverse (5′TTATAGGGGCAGTAGGCACG 3′) is underlined, but the first 5 nt of the primer were located at positions 1 to 5 in the circular genome and are not shown in the alignment. (b) Direct repeats in the HVR of the variants STTV1-GA1, STTV1-GA4, STTV1-GB1, and STTV-GB2. PR, 13-nt perfect direct repeat in the form of CCATCAGAGAATC; NPR, 11-nt near-perfect direct repeat in the form of (T/C)CATCAGAGAATC. The position of the last nucleotide shown in each variant is noted on the right.

Similar articles

See all similar articles

Cited by 44 articles

See all "Cited by" articles

Publication types

LinkOut - more resources

Feedback