Serine- and arginine-rich proteins 55 and 75 (SRp55 and SRp75) induce production of HIV-1 vpr mRNA by inhibiting the 5'-splice site of exon 3

Abstract

HIV-1 non-coding exon 3 can either be spliced to exons 4, 4a, 4b, 4c, and 5 to generate tat, rev, and nef mRNAs or remain unspliced to produce the 13a7 vpr mRNA. Here we show that serine- and arginine-rich proteins 55 and 75 (SRp55 and SRp75) inhibit splicing from the 5'-splice site of exon 3 thereby causing an accumulation of the partially unspliced 13a7 vpr mRNA. In contrast, serine- and arginine-rich protein 40 (SRp40) induces splicing from exon 3 to exon 4, thereby promoting the production of the 1347 tat mRNA. We demonstrate that SRp55 stimulates vpr mRNA production by interacting with the previously identified HIV-1 splicing enhancer named GAR and inhibiting its function. This inhibition requires both serine arginine-rich and RNA-binding domains of SRp55, indicating that production of HIV-1 vpr mRNA depends on the interaction of SRp55 with an unknown factor.

FIGURE 1.

A, schematic representation of the HIV-1 subgenomic plasmid pNL13a7 (7). The mRNAs produced from the plasmid are indicated below as well as the oligonucleotides used for RT-PCR and probe used for northern blotting. B, Northern blot of total cytoplasmic RNA extracted from HeLa cells transfected with pNL13a7 (7) in the absence or presence of CMV promoter-driven plasmids expressing SRp20, SRp30c, SRp40, SRp55, SRp75, or SC35. The blot was probed with exon 1 probe (A) detecting all HIV-1 mRNAs. Various mRNAs detected by the probe are indicated. C, RT-PCR on the RNA used in B performed with oligonucleotides Exon3s and BAMA (A). Bands representing mRNAs are indicated. M represents the molecular weight marker. D, SR proteins were detected by Western blot analysis using monoclonal antibody 1H4. Monoclonal antibody detection of enolase was used as loading control.

FIGURE 2.

A, schematic representation of the HIV-1 subgenomic plasmid pDP, which is derived from pNL43 (48) and contains a deletion between nucleotides 1571 and 3516 (numbers refer to HXB2R sequence). The three HIV-1 mRNA size classes, and vpr mRNA 13a7, are indicated below plasmid pDP. Arrows indicate oligonucleotides used for RT-PCR. The Northern blot probe is indicated. B, RT-PCR on cytoplasmic RNA extracted from HeLa cells transfected with pDP in the absence or presence of pCMVSRp40 or pCMVSRp55. Duplicate transfections are shown. The RT-PCR was performed with the oligonucleotides Exon3s and BAMA (A). The different bands represent the indicated mRNAs. C, Northern blot of cytoplasmic RNA extracted from HeLa cells transfected with pDP in the absence or presence of increasing concentrations of pCMVSRp55 or pCMVSRp75. The mRNA size classes are indicated. *, the shift in migration of 2-kb mRNAs. D, the RNAs in C were used for RT-PCR with oligonucleotides Exon3s and BAMA (A) that detect mRNAs containing exon 3. E, RT-PCR on cytoplasmic RNA extracted from HeLa cells transfected with pDP in the absence or presence of pCMVSRp40, pCMVSRp55, or pCMVSRp75. The RT-PCR was performed with the oligonucleotides BSS and BAMA (A) detecting all HIV-1 mRNAs. The bands representing mRNAs are indicated. M represents the molecular weight marker.

FIGURE 3.

A, schematic representation of the HIV-1 subgenomic plasmids pDP and pNL13a7sd1. Nucleotide positions of the deletions and insertions are indicated. The sequences of the different splice donors SD1 and SD3 are shown and compared with an optimal U1 snRNA binding site. B, Northern blot of cytoplasmic RNA extracted from HeLa cells transfected with pNL13a7 (w) (7) or pNL13a7sd1 (sd1) in the absence or presence of CMV promoter-driven plasmids expressing SRp55 or SRp75. The blot was probed with exon 1 probe (Fig. 2A), detecting all HIV-1 mRNAs. Identified mRNAs are indicated. C, the RNAs in B were subjected to RT-PCR with oligonucleotides Exon1s and BAMA (Fig. 1A) detecting all mRNAs. Bands representing mRNAs are indicated. M represents the molecular weight marker. Gapdh amplification was used as a control. D, RT-PCR performed on cytoplasmic RNA extracted from HeLa cells transfected with HIV-1 subgenomic plasmids pNL13a7 (w) or pNL13a7sd1 (sd1) in the absence or presence of CMV promoter-driven plasmid-expressing SRp40. Oligonucleotides Exon1s and BAMA (Fig. 1A) were used to detect all HIV-1 mRNAs. The bands representing mRNAs are indicated. M represents the molecular weight marker.

FIGURE 4.

A, schematic representation of HIV-1 subgenomic plasmids pNL13a7 (7), pNL13a7de3, and pNL13a7di3. Nucleotide positions of deletions are indicated. B and C, Northern blots with RNA extracted from HeLa cells transfected with pNL13a7 (w), pNL13a7de3 (de3), or pNL13a7di3 (di3) in the absence or presence of CMV promoter-driven plasmids expressing SRp55 or SRp75. The blots were probed with exon 1 probe (Fig. 1A) detecting all HIV-1 mRNAs. Detected mRNAs are indicated.

FIGURE 5.

A, schematic representation of a segment of HIV-1 subgenomic plasmids pNL13a7 (7), pNL13a7d, and pNL13a7d4. Nucleotide positions of deletions are indicated. B, Northern blot with RNA extracted from HeLa cells transfected with pNL13a7 (w) or pNL13a7d (d) in the absence or presence of CMV promoter-driven plasmids expressing SRp40, SRp55, or SRp75. The Northern blot was probed with exon 1 probe (Fig. 1A) detecting all HIV-1 mRNAs. Detected mRNAs are indicated. C, RT-PCR with oligonucleotides Exon3s and BAMA (Fig. 1A) performed on the RNAs also analyzed in B. Bands representing mRNAs are indicated. M represents the molecular weight marker. D, RT-PCR on RNA extracted from HeLa cells transfected with pNL13a7 (w) or pNL13a7d4 (d4) in the absence or presence of plasmids expressing SRp40, SRp55, and SRp75. The oligonucleotides used were Exon3s and BAMA (Fig. 1A). Bands representing mRNAs are indicated. M represents the molecular weight marker.

FIGURE 6.

A, schematic representation of segments of the HIV-1 subgenomic plasmids pNL13a7 (7), pNL13a7dG, and pNL13a7sd1dG. B and D, Northern blot with RNA extracted from HeLa cells transfected with pNL13a7 (w) or pNL13a7dG (dg) in the absence or presence of CMV promoter-driven plasmids expressing SRp40, SRp55, or SRp75. The blots were probed with exon 1 probe (Fig. 1A). All detected mRNAs are indicated. C, RT-PCR with RNA extracted from HeLa cells transfected with pNL13a7 (w) or pNL13a7dG (dg) in the absence or presence of CMV promoter-driven plasmids expressing SRp40, SRp55, or SRp75. RT-PCR oligonucleotides Exon3s and BAMA (Fig. 1A) were used. The bands representing mRNAs are indicated. M represents the molecular weight marker. E, RT-PCR with RNA extracted from HeLa cells transfected with pNL13a7sd1 (sd1) (Fig. 3A) or pNL13a7sd1dG (sd1dg) in the absence or presence of CMV promoter-driven plasmid expressing SRp55. Oligonucleotides used for RT-PCR were Exon1s and BAMA (Fig. 1A). Bands representing mRNAs are indicated. M represents the molecular weight marker.

FIGURE 7.

A, schematic representation of the HPV-16 subgenomic plasmids pT1sd and pT1sde (29) as well as the HPV-16 subgenomic plasmid containing the HIV-1 exon 5 sequence, including the GAR sequence (25, 26), pT1–5/GAR. The L1 and L1i mRNAs produced from these plasmids are indicated. Arrows indicate PCR oligonucleotides 757s and L1AM used for RT-PCR. B, the HIV-1 sequence inserted in pT1sd is shown with the GAR sequence indicated in bold. C, RT-PCR, with oligonucleotides 757s and L1AM, on RNA extracted from HeLa cells transfected with pT1sd, pT1sde, or pT1–5/GAR in the absence or presence of CMV promoter-driven plasmid expressing SRp55. Bands representing L1 or L1i mRNAs are indicated. M represents the molecular weight marker. D, RT-PCR on RNA extracted from HeLa cells transfected with pT1–5/GAR in the absence or presence of various concentrations of SRp55 plasmid. M represents the molecular weight marker.

FIGURE 8.

A, representation of GAR sequence used as probe for RNA gel shift assay. Potential binding sites for SRp40 and SRp55 are indicated according to ESEfinder® (37, 38). B, RNA gel shift assay with radiolabeled GAR RNA and purified gst protein (gst) or purified gst SRp55 protein (gst SRp55). Increasing amounts of unlabeled GAR RNA (competitor). Free and bound probe are indicated. C, RNA gel shift assay with radiolabeled HPV-1 RNA named AUM/UM (34) and purified gst protein (gst) or purified gst SRp55 protein (gst SRp55). The AUM/UM RNA is 57 nucleotides and has an AU content of 76%, and the sequence of the AUM/UM mRNA is the following: AUACCUAUUAGUAGAUUACCUAUUAUAUAUUCCUAUAUUCCUAUACUUCCUAUACUU.

FIGURE 9.

A, Northern blot with RNA extracted from HeLa cells transfected with plasmid pNL13a7 (7) (Fig. 1A) in the absence or presence of CMV promoter-driven plasmid expressing SRp40 and serially diluted CMV promoter-driven plasmids expressing SRp55 or SRp75. The blot was probed with exon 1 probe (Fig. 1A) detecting all mRNAs. Identified mRNAs are indicated. B, acrylamide gel showing RT-PCR with oligonucleotides Exon3s and BAMA (Fig. 1A) on cytoplasmic RNA from HeLa cells transfected with pDP (Fig. 2A) in the absence or presence of CMV promoter-driven plasmid expressing SRp55 or SRp55-dRS, which is lacking the RS domain. vpr, tat, and nef mRNAs are indicated. M represents the molecular weight marker. C, agarose gels showing RT-PCR reactions with oligonucleotides Exon3s and BAMA (Fig. 1A) on cytoplasmic RNA from HeLa cells transfected with pNL13A7 in the absence or presence of 133 nm siRNA against SRp55 and SRp75 (SMARTpool Dharmacon). The lower panel shows RT-PCR on cytoplasmic RNA from HeLa cells transfected with pNL13A7 in the absence or presence of either 133 nm or 27 nm of siRNAs against SRp55 and SRp75 (SMARTpool Dharmacon). The right panel shows RT-PCR on SRp55 mRNA in the absence or presence of siRNAs against SRp55 and -75.