Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2010 Oct;1207 Suppl 1(Suppl 1):E7-15.
doi: 10.1111/j.1749-6632.2010.05714.x.

Soluble VEGFR-2: An Antilymphangiogenic Variant of VEGF Receptors

Affiliations
Free PMC article

Soluble VEGFR-2: An Antilymphangiogenic Variant of VEGF Receptors

Helena Pavlakovic et al. Ann N Y Acad Sci. .
Free PMC article

Abstract

The vascular endothelial growth factor (VEGF) family of secreted proteins and their receptors are major regulators of blood vessel development (hemangiogenesis) and lymphatic vessel development (lymphangiogenesis). VEGF acts through a complex system of receptor tyrosine kinases, which can be membrane bound or soluble. New data concerning the receptor system are still emerging, thus contributing to the complexity of the system. Very recently a soluble form of VEGFR-2, termed sVEGFR-2, which is a result of alternative splicing, has been discovered. Earlier, it has been shown that a secreted/soluble form of VEGFR-1, termed sVEGFR-1, is produced by alternative splicing and exerts an antihemangiogenic effect by binding VEGF-A. The newly discovered spliced variant of sVEGFR-2 binds the lymphangiogenic growth factor VEGF-C and thus inhibits VEGF-C-induced activation of VEGFR-3, consequently inhibiting lymphatic endothelial cell proliferation. Its inactivation in murine embryos permits hyperplasia of dermal lymphatics and invasion of lymphatics into the cornea. Tumor lymphangiogenesis seems to influence the metastatic behavior of malignant cells. A correlation has been found between the downregulation of sVEGFR-2 and the malignant progression of neuroblastoma, which is characterized by lymphogenic metastases in progressed stages. Data show that lymphangiogenesis is regulated by both activators and inhibitors, and its balance is crucial in health and disease.

Figures

Figure 1
Figure 1
Immunostaining of membrane-bound VEGFR-2 (mbVEGFR-2) in human foreskin (green) shows its localization on blood vascular and lymphatic endothelial cells (the latter are red by anti-Prox-1 nuclear staining). Dapi staining (blue) was used to demonstrate cell nuclei. A) Bar = 100μm. B) Bar = 50μm.
Figure 2
Figure 2
Immunostaining of sVEGFR-2 in human foreskin. A) Dapi staining of nuclei. B) Anti-sVEGFR-2. C) Merged picture. D) Negative control. Soluble VEGFR-2 is primarily expressed in the epidermis and in blood vessels in the dermis. Non-specific fluorescence is visible in the hornifying layer of the epidermis. Bar = 200μm.
Figure 3
Figure 3
Immunostaining of the cornea of a LeCre;svegfr-2loxP/loxP newborn mouse, which selectively lacks svegfr-2 in the cornea. A) CD31, a pan-endothelial cell marker is stained red corneal vessels. B) A specific marker for lymphatic endothelial cells, Lyve-1 (lymphatic vascular endothelial hyaluronan receptor-1) stains corneal lymphatics in green. C) Merged image of CD31 and Lyve-1 staining demonstrates that all vessels within the cornea are lymphatic vessels, whereas in the limbus both types of vessels are present. The arrows point to typical blind-ended morphology of lymphatic vessels.
Figure 4
Figure 4
Expression of sVEGFR-2 in 49 neuroblastoma (NB) tissue samples, as determined by real-time RT-PCR. The expression levels (bars, and standard error of the mean) are shown separately for each tumor stage. Tumor stages 3, 4 and 4s (progressed NB) demonstrate statistically (p < 0.05) significantly lower levels of sVEGFR-2 compared to localized stages 1 and 2. Primers used for RT-PCR were: sVEGFR-2 fwd: 5′- GCCTTGCTCAAGACAGGAAG -3′; sVEGFR-2 rev: 5′- CAACTGCCTCTGCACAATGA -3′. β-Actin fwd: 5′- GCATCCCCCAAAGTTCACAA -3′; β-Actin rev: 5′- AGGACTGGGCCATTCTCCTT -3′.
Figure 5
Figure 5
Schematic presentation of the VEGF ligands and their interaction with membrane-bound and soluble (secreted) VEGF receptors. Notably, inhibitory effects are exerted by sVEGFR-1 (anti-hemangiogenesis) and sVEGFR-2 (anti-lymphangiogenesis). ). Neuropilin-2 (NRP-2) also interacts with VEGFR-3 on lymphatic endothelial cells, which is not shown in this scheme . NRP-1: Neuropilin-1. Modified from: http://www.rosenthallab.com/gallery/images/VEGF_VEGFR.jpeg

Similar articles

See all similar articles

Cited by 20 articles

See all "Cited by" articles

MeSH terms

Substances

LinkOut - more resources

Feedback