The complete sequence of a unique RNA species synthesized by a DI particle of VSV

Cell. 1978 Sep;15(1):103-12. doi: 10.1016/0092-8674(78)90086-7.

Abstract

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.

MeSH terms

  • Base Sequence
  • Defective Viruses / genetics*
  • Genes, Viral
  • Oligoribonucleotides / analysis
  • RNA, Viral / biosynthesis
  • RNA, Viral / genetics*
  • Templates, Genetic
  • Transcription, Genetic
  • Vesicular stomatitis Indiana virus / genetics*
  • Virus Replication

Substances

  • Oligoribonucleotides
  • RNA, Viral