Hox proteins coordinate peripodial decapentaplegic expression to direct adult head morphogenesis in Drosophila

Abstract

The Drosophila BMP, decapentaplegic (dpp), controls morphogenesis of the ventral adult head through expression limited to the lateral peripodial epithelium of the eye-antennal disc by a 3.5 kb enhancer in the 5' end of the gene. We recovered a 15 bp deletion mutation within this enhancer that identified a homeotic (Hox) response element that is a direct target of labial and the homeotic cofactors homothorax and extradenticle. Expression of labial and homothorax are required for dpp expression in the peripodial epithelium, while the Hox gene Deformed represses labial in this location, thus limiting its expression and indirectly that of dpp to the lateral side of the disc. The expression of these homeodomain genes is in turn regulated by the dpp pathway, as dpp signalling is required for labial expression but represses homothorax. This Hox-BMP regulatory network is limited to the peripodial epithelium of the eye-antennal disc, yet is crucial to the morphogenesis of the head, which fate maps suggest arises primarily from the disc proper, not the peripodial epithelium. Thus Hox/BMP interactions in the peripodial epithelium of the eye-antennal disc contribute inductively to the shape of the external form of the adult Drosophila head.

Fig. 1

A 15 bp deletion disrupts expression of dpp from a putative Hox enhancer element. Adult heads from (A) wild-type and (B) dpp^s-hc1 mutant. Arrow indicates disrupted vibrissae. (C) LacZ expression driven by the 660 bp construct, SH06 in the eye-antennal disc. (D) Expression is lost from SH06-hc1 which includes the 15 bp deletion from dpp^s-hc1. (E) DNA sequence surrounding the 15 bp deletion (shown in bold text); consensus binding sites for Hox, Hth, Exd, and the putative Mad/Med/Brinker AE are identified. (F) EvoPrinterHD analysis of the region around 15 bp deletion shows conserved nucleotides in capital letters, non-conserved in lower case, and consensus sites as in (E).

Fig. 2

Consensus sites bind Lab, Hth and Exd in vitro and are required for reporter expression in vivo. (A) EMSA of oligo 'A' (see D) with Exd and Lab. Lanes 1–4 are wild type oligo 'A', lane 5 is oligo 'A' with mutations introduced into the Exd/Lab (TGTCGACTCG) site, and lanes 6–9 is an oligo (AAATTGATGGATTGCCCGGC) containing the Lab/Exd binary site from the lab 48/95 autoregulatory element (Ryoo et al., 1999) Arrow indicates the shift. (B) EMSA of oligo 'B' with Exd, Hth, Lab, and combinations of each (lanes 1–7). Lanes 4 and 8 are oligo 'B' with mutations introduced into the Exd/Lab site (TGTCGACTCG), and Hth sites (TATACTTATACGG). Arrows indicate the shifts. An smaller unexplained band is observed upon addition of Hth and Exd with this oligo. (C) EMSA of oligo 'C' with Exd and Hth (lanes 1–4). Lane 5 is oligo 'C' with a single CTTATA mutation introduced into the Hth sites. (E–L) Histochemical detection of SH42 LacZ expression from (E) wild type (F) single Exd mutation, (G) Exd/Lab site mutation, (H) single Hox site mutation, (I) Hth site mutation, (J) mutation in both Exd sites, (K) mutations in both of the TAAT Hox sites, or (L) triple Hox site mutations. (M) Hox response element in the dpp^hc enhancer. Sequences of all mutants introduced in the reporter constructs are indicated with the respective letter from the photos above. The Exd/Lab mutant sequence in G and the Hth mutant sequence in I are from (Ryoo et al., 1999).

Fig. 3

Lab, Dfd, and dpp^s-hc-lacZ are expressed in the lateral PE of the eye-antennal disc. Expression of Lab (A), Dfd (B), and dpp^s-hc-lacZ (SH53)(C) in PE of the eye-antennal disc. White box in A indicates region of higher magnification shown in D-F, with expression for Lab (D), Dfd (E), and dpp^s-hc-lacZ (F). G-I are merges of Lab and dpp^s-hc-lacZ (G); Lab and Dfd (H) showing approximately two cell overlap (bracket), and (I) a merge of all three showing the most medial expression of dpp^s-hc-lacZ localizes with the area of overlap between Lab and Dfd (arrow). (J) Confocal cross-section of merge in I shows peripodial restriction of all three. Discs are oriented with lateral (future ventral) to the left and posterior down, in this and in all subsequent figures.

Fig. 4

lab LOF clones show reduced expression of dpp^s-hc-lacZ. (A–B) Homozygous lab LOF clones (loss of green GFP expression) induced with hs FLP/FRT show reduction in expression of dpp^s-hc-lacZ (arrows). (C) GOF clones of UAS-lab (co-localized with GFP expression in green) produce ectopic expression of dpp^s-hc-lacZ (arrow) but only in clones adjacent to the endogenous dpp domain. (D) Cross section of disc shown in C. (E) Homozygous lab mutant clones induced with hs FLP, cause loss of Dfd expression, based on the location of the clone; result is either complete loss (arrow 1), partial loss (arrow 2), or no loss (arrow 3). Blue is nuclear DAPI staining in this and in all subsequent figures.

Fig. 5

Dfd affects dpp expression by repression of lab. (A) Eye-antennal disc showing wild type expression of dpp^s-hc-lacZ. (B) Dfd mutant clones (loss of green GFP expression) induced with hs FLP disrupt reporter expression but not specifically within mutant clones. (C) Ectopic expression of dpp^s-hc-lacZ (arrow) in a Dfd LOF clone adjacent to the endogenous dpp domain. (D) Higher magnification of clone depicted in (C) shows ectopic expression medial to the dpp domain (arrow), and non-cell autonomous changes (bracket) within the dpp domain. Arrowhead marks Dfd mutant clone not expressing dpp^s-hc-lacZ (E) Homozygous LOF Dfd clones (white outlines) result in ectopic expression of Lab. The endogenous lab domain is delineated with brackets. (F) GOF clones expressing UAS-Dfd (arrow) inhibit expression from lab reporter construct P3.65lab 66A.

Fig. 6

hth is required for dpp expression. (A) Homozygous mutant hth LOF clones induced with hs FLP show complete cell autonomous loss of dpp^s-hc-lacZ expression (arrows). (B) Clones expressing UAS-hth activate ectopic expression of dpp^s-hc-lacZ (arrows) but only in PE clones along the posterior margin of the eye disc (cross section in C). Lateral is to the left, except in C where PE is up.

Fig. 7

lab limits dpp expression from the dpp head capsule enhancer to the peripodial epithelium. GOF clones expressing both UAS-hth and UAS-lab ectopically express dpp^s-hc-lacZ in both the PE (A–C) and the DP (D–F). (G–I) Clones expressing UAS-opa result in broad ectopic expression of dpp^s-hc-lacZ restricted to PE, while DP clones expressing both UAS-opa and UASlab express dpp^s-hc-lacZ (J–L). (M–O) Clones expressing UAS-tkv^QD result in PE-restricted expression of dpp^s-hc-lacZ, only in clones adjacent to the endogenous dpp domain. (P–R) DP Clones expressing both UAS-tkv^QD and UAS-lab result in ectopic expression of dpp^s-hc-lacZ. Discs are oriented lateral to the left, except for cross sections C, F, I, L, O, R where PE is up.

Fig. 8

Dpp signaling affects the expression of lab and hth. (A) Homozygous LOF tkv clones (loss of green GFP) induced with hs FLP result in a reduction in P3.65lab 66A reporter expression. (B) Homozygous mutant LOF tkv clones result in a cell autonomous increase in hth^dtl-S142204 enhancer trap expression. (C) GOF clone expressing UAS-brk shows a loss of dpp^s-hc-lacZ reporter expression within the clone boundary. Arrows indicate clones of interest.

Fig. 9

Model for the regulation of dpp in the PE of the eye-antennal disc. (A) Diagram detailing epistatic relationships controlling the expression of dpp in the PE. Grey lines indicate results seen in GOF experiments alone. (B) Identified Lab response sites. b1-ARE and lab 48/95 sequences are modified from (Mann et al., 2009). (C–F) PE expression of Lab (antibody)(C), Hth (hth^dtl-S142204 enhancer trap)(D), Dpp signaling (phospho-Smad antibody)(E), and Brk (brk-lacZ)(F). (G) Diagram of factors involved in regulation of the dpp^hc enhancer on the lateral, middle and medial sides of the PE.