Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
, 2012, pls019

Adaptation to Flooding During Emergence and Seedling Growth in Rice and Weeds, and Implications for Crop Establishment

Affiliations

Adaptation to Flooding During Emergence and Seedling Growth in Rice and Weeds, and Implications for Crop Establishment

Abdelbagi M Ismail et al. AoB Plants.

Abstract

Background and aims: Direct seeding of rice is being adopted in rainfed and irrigated lowland ecosystems because it reduces labour costs in addition to other benefits. However, early flooding due to uneven fields or rainfall slows down seed germination and hinders crop establishment. Conversely, early flooding helps suppress weeds and reduces the costs of manual weeding and/or dependence on herbicides; however, numerous weed species are adapted to lowlands and present challenges for the use of flooding to control weeds. Advancing knowledge on the mechanisms of tolerance of flooding during germination and early growth in rice and weeds could facilitate the development of improved rice varieties and effective weed management practices for direct-seeded rice.

Principal results: Rice genotypes with a greater ability to germinate and establish in flooded soils were identified, providing opportunities to develop varieties suitable for direct seeding in flooded soils. Tolerance of flooding in these genotypes was mostly attributed to traits associated with better ability to mobilize stored carbohydrates and anaerobic metabolism. Limited studies were undertaken in weeds associated with lowland rice systems. Remaining studies compared rice and weeds and related weed species such as Echinochloa crus-galli and E. colona or compared ecotypes of the same species of Cyperus rotundus adapted to either aerobic or flooded soils.

Conclusions: Tolerant weeds and rice genotypes mostly developed similar adaptive traits that allow them to establish in flooded fields, including the ability to germinate and elongate faster under hypoxia, mobilize stored starch reserves and generate energy through fermentation pathways. Remarkably, some weeds developed additional traits such as larger storage tubers that enlarge further in deeper flooded soils (C. rotundus). Unravelling the mechanisms involved in adaptation to flooding will help design management options that will allow tolerant rice genotypes to adequately establish in flooded soils while simultaneously suppressing weeds.

Figures

Fig. 1
Fig. 1
Soluble sugar concentrations in seeds of flooding-tolerant Khaiyan and Khao Hlan On (KHO) and intolerant IR42 after 0 (dry), 24 and 72 h of hypoxia. Seeds were incubated in 0.1 % sterile agar solution maintained under hypoxia (0.03 mol O2 m−3) by bubbling with N2 gas. Analysis was performed as described in Ismail et al. (2009). Data are means of two experiments, each with two biological replicates, and vertical bars are ±SE.
Fig. 2
Fig. 2
Expression of vacuolar H+-pyrophosphatase (OVP3) under hypoxia in Khao Hlan On and IR42 at 0 (dry), 24, 48 and 72 h of hypoxia. Seeds were incubated in 0.1 % sterile agar solution maintained under hypoxia (0.03 mol O2 m−3) by bubbling with N2 gas. RNA extraction and reverse transcriptase-polymerase chain reaction analysis was performed as described in Ismail et al. (2009). The following primers were used: OVP3F, 5′-AATTTGAGGACGGACGGAGAT-3′; OVP3R, 5′-GGCTCAGGCAGACAGAAACT-3′; OVP4F, 5′CTGGGACAATGCCAAGAAAT-3′; OVP4R, 5′-ATGATTGTTTACTCCGTGCG-3′ (Liu et al. 2010). Adh1 expression was included as a check for weak housekeeping gene GAPDH at 0 (dry) time-point and genomic DNA (gDNA) for OVP3 and OVP4 was used to check for effectiveness of the primers and gene presence. The Adh1 primers used were: Adh1F, 5′- CCAGTTCAGCAGGTACTTGC -3′; Adh1R, 5′- CAGGATACACAGAAGAACCG -3′ (Fukao et al. 2006).
Fig. 3
Fig. 3
Effects of flooding depth and duration on seedling emergence (%) of C. difformis, C. iria and F. miliacea (adapted from Chauhan and Johnson 2009).

Similar articles

See all similar articles

Cited by 20 PubMed Central articles

See all "Cited by" articles

References

    1. Al-Ani A, Bruzau F, Raymond P, Saint-Ges V, Leblanc JM, Pradet A. Germination, respiration, and adenylate energy charge of seeds at various oxygen partial pressures. Plant Physiology. 1985;79:885–890. - PMC - PubMed
    1. Alpi A, Beevers H. Effect of O2 concentration on rice seedlings. Plant Physiology. 1983;71:30–34. - PMC - PubMed
    1. Angaji SA, Septiningsih EM, Mackill DJ, Ismail AM. Identification of QTLs associated with tolerance of anaerobic conditions during germination in rice (Oryza sativa L.) Euphytica. 2010;172:159–168.
    1. Atwell BJ, Greenway H. Carbohydrate metabolism of rice seedlings grown in oxygen-deficient solution. Journal of Experimental Botany. 1987;38:466–478.
    1. Avadhani PN, Greenway H, Lefroy R, Prior L. Alcoholic fermentation and malate metabolism in rice germinating at low oxygen concentrations. Australian Journal of Plant Physiology. 1978;5:15–25.
Feedback