Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
, 154 (6), 1285-99

Diverse Autophagosome Membrane Sources Coalesce in Recycling Endosomes

Affiliations

Diverse Autophagosome Membrane Sources Coalesce in Recycling Endosomes

Claudia Puri et al. Cell.

Abstract

Autophagic protein degradation is mediated by autophagosomes that fuse with lysosomes, where their contents are degraded. The membrane origins of autophagosomes may involve multiple sources. However, it is unclear if and where distinct membrane sources fuse during autophagosome biogenesis. Vesicles containing mATG9, the only transmembrane autophagy protein, are seen in many sites, and fusions with other autophagic compartments have not been visualized in mammalian cells. We observed that mATG9 traffics from the plasma membrane to recycling endosomes in carriers that appear to be routed differently from ATG16L1-containing vesicles, another source of autophagosome membrane. mATG9- and ATG16L1-containing vesicles traffic to recycling endosomes, where VAMP3-dependent heterotypic fusions occur. These fusions correlate with autophagosome formation, and both processes are enhanced by perturbing membrane egress from recycling endosomes. Starvation, a primordial autophagy activator, reduces membrane recycling from recycling endosomes and enhances mATG9-ATG16L1 vesicle fusion. Thus, this mechanism may fine-tune physiological autophagic responses.

Figures

None
Figure 1
Figure 1
mATG9 Is Internalized by Clathrin-Mediated Endocytosis (A′) HeLa cells transfected with pEGFP-RAB11 were fixed in basal conditions and stained for mATG9. Pearson’s coefficient: 0.452 ± 0.034 (SEM). (A″) HeLa cells were transfected with ATG9L1-pEGFP, fixed in basal condition, and labeled for RAB11. Pearson’s coefficient: 0.413 ± 0.020 (SEM). (B) HeLa cells were incubated for 1 hr at 37°C or 18°C to reach the correct temperature, loaded with transferrin Alexa-555 for 1 hr, fixed, and labeled with anti-ATG9 and anti-TGN46 (marker for Trans Golgi Network). Histogram shows Pearson’s coefficient between ATG9 and transferrin (Tf) or TGN46. Error bar, SEM. ∗∗∗p < 0.001. Inserts show merge at higher magnification. (C) HeLa cells were incubated in serum-free medium containing Dynasore 100 μM or DMSO for 2 hr and loaded for 30 min with transferrin Alexa-555. Cells were then fixed and labeled for mATG9 and TGN46. Pearson’s coefficient between mATG9 and transferrin or TGN46 was quantified. Error bar, SEM. ∗∗∗p < 0.001. Inserts show the merge at higher magnification. (D) Cells treated or not treated with Dynasore or transfected with Dynamin K44A mutant or AP2 siRNA were fixed and then analyzed by TIRF microscopy. Pictures are at the same magnification and brightness. Cells transfected with Dynamin mutant were identified by abnormal transferrin accumulation at the plasma membrane. (E) HeLa cells were incubated for 1 hr at 4°C with ice-cold NHS-LC-Biotin (Pierce) solution, rinsed, and lysed in RIPA buffer. Biotinylated proteins were precipitated using streptavidin-agarose beads (Pierce) and blotted for mATG9 to assess protein localization at the plasma membrane. (F) HeLa cells treated as in (C) were processed for immunogold labeling on cryosections and stained with anti-mATG9 antibody. Arrows show clathrin-coated structures. Scale bar in a and c, 150 nm; scale bar in b, 100 nm. (G) HeLa cells transfected with GFP-ATG16L1 were fixed, labeled for mATG9, and then analyzed by TIRF microscopy. Control cells were cotransfected with GFP-ATG16L1 and Straw-ATG16L1. Pictures are at the same magnification and brightness. See Figure S1J for quantification. (H) HeLa cells treated with Dynasore were processed for immunogold labeling on cryosections and double labeled with ATG16L1 (10 nm) and mATG9 (15 nm). Scale bar, 100 nm. (I) HeLa cells treated as in (H) were processed for triple labeling on cryosections (clathrin, 5 nm; ATG16L1, 10 nm; and mATG9, 15 nm). Scale bar, 150 nm. (J) Table shows quantification of numbers of clathrin-coated structures carrying mATG9 and ATG16L1 alone or together or neither protein. A minimum of 50 clathrin-coated structures were examined from three different experiments. We constructed a 2 × 2 table with 0 or 1–3 gold particles for mATG9 or ATG16L1 for a X2 test to avoid statistical cells with 0 counts. X2 = 10.4, df = 1, and p = 0.001. See also Figure S1.
Figure 2
Figure 2
ATG16L1 Is Found in Recycling Endosomes (A) HeLa cells transfected with GFP-ATG16L1 for 24 hr were incubated for 15 min with 2.5 μg/ml with HRP-cholera toxin subunit B at 4°C and then for 10 min at 37°C. Cells were then fixed and treated for immunogold labeling on cryosections. ATG16L1 was detected with anti-ATG16L1 antibody (15 nm), and cholera toxin was detected using anti-HRP antibody. Scale bar, 150 nm. (B) HeLa cells were transiently transfected with GFP-ATG16L1 for 20 hr. Cells in basal conditions were fixed and labeled with anti-RAB11 antibody. (C) HeLa cells transfected with mStrawberry-ATG16L1 (20 hr) and starved (4 hr) were processed for immunogold labeling on cryosections. Double labeling was performed with rabbit anti-ATG16L1 (10 nm gold) and rabbit anti-RAB11 (15 nm gold). Scale bar, 150 nm. Schematic diagram shows membrane outlines from EM. Green lines indicate structures positive for both ATG16L1 and RAB11, whereas red lines are only positive for RAB11. Histogram shows the percentage by EM of ATG16L1 tubulovesicular structures that carry RAB11. 281 tubulovesiclular structures from different experiments were analyzed. Error bars, SD. (D) HeLa cells were transfected with EGFP-ATG16L1 and mCherry-RAB11, and 5 min movies were recorded. Representative images from movies are shown. (E) HeLa cells were loaded with mouse anti-transferrin receptor antibody (5E9C11) for 30 min and fixed for immunogold labeling for cryosections. The sample was labeled with rabbit anti-mouse antibody to recognize transferrin receptor (5 nm), anti-ATGL116 (10 nm), and anti-mATG9 (15 nm). Scale bar, 150 nm. (F) HeLa cells were transfected with pmStrawberry-ATG16L1 and ATG9L1-pEGFP, and 5 min movies were recorded. Representative images from the movies are shown. (G) HeLa cells were transfected with pmStrawberry-ATG16L1 and pEGFP-LC3, starved for 2 hr, fixed, and labeled for mATG9. See also Figure S2 and Movies S1 and S2.
Figure 3
Figure 3
mATG9 and ATG16L1 Meet in Recycling Endosomes (A and B) (A) HeLa cells were incubated for 4 hr at 37°C or 18°C and processed for LC3II western blot. Some cells were incubated overnight with 20 mM NH4Cl in full medium (to block lysosomal degradation) at 37°C or 18°C (B). (C) HeLa cells were transfected with pEGFP-LC3 for 20 hr and incubated for 4 hr at 37°C or 18°C. (D and E) (D) HeLa cells were transfected with pEGFP-ATG16L1 for 20 hr and incubated for 4 hr at 37°C or 18°C. The size and the number (E) of vesicles were scored (a minimum of 20 cells were examined for each condition). Error bar, SEM. ∗∗∗p < 0.001 and ∗∗p < 0.01. (F and G) (F) HeLa cells were transfected with pEGFP-ATG16L1 for 20 hr, incubated for 4 hr at 37°C or 18°C, and labeled with EEA1 or RAB11 to visualize early endosomes or recycling endosomes. Histogram in (G) shows the amount of colocalization of ATG16L1 in EEA1 or in RAB11 compartment (Manders’ coefficient). Error bar, SEM. NS, not significant; ∗∗p < 0.01. (H) HeLa cells were transfected with pmStrawberry-ATG16L1 for 20 hr, fixed, and labeled for mATG9. The histograms show quantification of colocalization and the size of the vesicles labeled with ATG16L1 and mATG9 at 37°C or 18°C. Error bar, SEM. ∗∗∗p < 0.001 and ∗∗p < 0.01. (I) HeLa cells were transfected with pEGFP-RAB11 or pEGFP-Myosin Vb tail (MVb) and incubated during the last 16 hr with Bafilomycin A1 (Baf) or DMSO and processed for LC3-II western blot. Control cells were transfected with pEGFP empty vector. (J) HeLa cells were transfected with ATG16L1-mStrawberry and RAB11-EGFP or MVb tail-EGFP. The size of ATG16L1 vesicles was scored in RAB11 and MVb tail overexpression conditions. The inserts show just the ATG16L1 vesicles as quantified in histogram. Error bar, SEM. ∗∗∗p<0.001. (K) HeLa cells were transfected as in (C) and loaded with transferrin Alexa-647 for 30 min. Histogram and the inserts show the correlation between ATG16L1 and the loaded transferrin (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. (L) HeLa cells were transfected as in (C) and labeled for mATG9. Histogram and the inserts show the correlation between ATG16L1 and mATG9 in RAB11 and MVb tail overexpression conditions (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. (M) HeLa cells were transfected with mStrawberry-ATG16L1 for 20 hr, starved in HBSS for 4 hr, or maintained in full medium, loaded with transferrin Alexa-488 (Tf). Pictures and histogram show the correlation between ATG16L1 and transferrin in basal and starving condition (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. (N) HeLa cells were transfected with mStrawberry-ATG16L1 for 20 hr, starved in HBSS for 4 hr, or maintained in full medium and then fixed and labeled with anti-mATG9 antibody. Pictures and histogram show the correlation between ATG16L1 and mATG9 in basal and starved cells (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. See also Figure S3 and Movies S3 and S4.
Figure 4
Figure 4
mATG9/ATG16L1 Vesicle Fusion Is SNARE Dependent (A) HeLa cells were transfected with mStrawberry-ATG16 for 20 hr and treated for 10 min with N-ethylmaleimide (NEM; 100 μM) in full medium, fixed, and stained for mATG9. Histogram shows correlation between mATG9 and ATG16L1 (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. (B) Schematic diagram of the in vitro fusion assay of ATG16L1 and mATG9 vesicles. Postnuclear supernatants (PNS) of cells expressing mStrawberry-ATG16L1 were mixed with PNS from cells expressing ATG9L1-GFP for 1 hr in the presence of ATP, ATP and NEM at 37°C, or with ATP on ice. The samples were fixed and mounted on a microscope slide with Mowiol 4-88 for confocal analysis. (C and D) (C) Representative fields of in vitro fusion assay of ATG16L1 and mATG9 vesicles. The quantification in (D) was performed on ten fields (similar to that shown in the figure) per experiment. The quantification is expressed as Pearson’s coefficient. Error bar, SEM. ∗∗p < 0.001.
Figure 5
Figure 5
VAMP3 Regulates Autophagy (A) HeLa cells were transfected with siRNAs for different R-SNAREs, and we assessed the levels of the autophagy substrate p62 versus actin. (B) HeLa cells transfected with control or VAMP3 siRNA (oligo A) for 4 days were treated during the last 16 hr with Bafilomycin A1 (Baf A1) or DMSO (basal) and processed for LC3-II western blots. (C) Endogenous LC3 immunocytochemistry in HeLa cells transfected with control or VAMP3 siRNA for 4 days. The histogram shows the number of vesicles (LC3 positive) in a minimum of 30 cells. Error bar, SEM. ∗∗∗p < 0.001. (D) HeLa cells were transfected with VAMP3-HA for 20 hr and stained for EEA1 or RAB11. Histogram shows colocalization between VAMP3-HA and EEA1 or VAMP3-HA and RAB11 (Manders’ coefficient). Error bar, SEM. (E) HeLa cells were transfected for 20 hr with VAMP3-HA, incubated for 1 hr at 37°C or 18°C, fixed, and labeled for HA and mATG9. Histogram shows the percentage of colocalization between VAMP3 with mATG9 (Manders’ coefficient). Error bar, SEM. NS, not significant. See also Figure S4.
Figure 6
Figure 6
VAMP3 Regulates mATG9 and ATG16L1 Trafficking (A–C) HeLa cells transfected with control, VAMP3 siRNA for 4 days were transfected during the last 20 hr with ATG9L1-pEGFP and labeled with anti-EEA1 (for early endosomes) or anti-RAB11 (for recycling endosomes). The histogram in (C) shows the quantification of the colocalization of mATG9 in EEA1 or RAB11 (Manders’ coefficient). Error bars, SEM. ∗∗∗p < 0.001. (D–F) HeLa cells were treated as in (A)–(C) and transfected during the last 20 hr with pEGFP-ATG16L1 and labeled with anti-EEA1 (early endosomes) or anti-RAB11 (recycling endosomes). Histogram in (D) shows quantification of the colocalization of ATG16L1 in EEA1 or RAB11 (Manders’ coefficient). Error bars, SEM. ∗∗∗p < 0.001; NS, not significant.
Figure 7
Figure 7
VAMP3 Is Required for Fusion of Vesicles Carrying mATG9 and ATG16L1 (A) HeLa cells transfected with control, VAMP3 siRNA for 4 days were transfected during the last 20 hr with mStrawberry-ATG16L1 and labeled for mATG9. The correlation between mATG9 and ATG16L1 was quantified (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. (B) HeLa cells were transfected with control or VAMP3 siRNA and then with mStrawberry-ATG16, and 5 min movies were recorded. Homotypic fusion events between mStrawberry-ATG16 vesicles were assessed in control and VAMP3 knockdown cells. Error bar, SEM. NS, not significant. (C) In vitro fusion assay of ATG16L1 and mATG9 vesicles. HeLa cells were transfected with control or VAMP3 siRNA for 4 days separately and, on the fourth day, either transfected with mStrawberry-ATG16L1 or ATG9L1-pEGFP. PNS of cells expressing the two constructs were mixed for 1 hr at 37C° and observed by confocal microscopy. Histogram shows the correlation of vesicles carrying ATG16L1 that fuse with vesicles carrying mATG9 (Pearson’s coefficient). Error bar, SEM. ∗∗∗p < 0.001. The total number of structures per field (ATG16L1 and ATG9L1) is not significantly different in the control and KD samples (control, 37 ± 3; VAMP3 KD, 45 ± 3; ± SEM; p = 0.106). (D) Schematic diagram of mATG9 and ATG16L1 itineraries pertinent to their heterotypic fusion and autophagosome formation. See also Figure S5 and Movies S5 and S6.
Figure S1
Figure S1
mATG9 Is Trafficked from the Plasma Membrane to Early Endosomes, Related to Figure 1 (A) HeLa cells were incubated 1 hr at 18°C or 37°C and loaded for 1h with transferrin Alexa-555. The pictures represent representative fields of transferrin localization at 18°C or 37°C. Transferrin localization appears more disperse at 18°C. (B) HeLa cells treated with the same protocol described in (A) were fixed and labeled with anti-EEA1 antibody (early endosome marker). At 18°C transferrin accumulates in early endosomes. The Pearson’s Coefficient between transferrin and EEA1 was quantified in the histogram. Error Bar = SEM. ∗∗∗ = p < 0.001. (C and C′) HeLa cells treated as in (A) were labeled with anti-RAB11 antibody – RAB11 is the most commonly used marker for recycling endosomes. At 18°C transferrin is no longer able to reach the recycling endosome and therefore shows less colocalization with RAB11. The Pearson’s Coefficient between transferrin and RAB11 was quantified in the histogram. Error Bar = SEM. ∗∗∗ = p < 0.001. (D and D′) HeLa cells treated as in (A) were transfected with ATG9L1-GFP and labeled with anti-EEA1- EEA1 is the most commonly used marker for early endosomes. At 18°C mATG9 is no longer able to exit from the endosome and therefore shows more colocalization with EEA1. The Pearson’s Coefficient between mATG9 and EEA1 was measured in the histogram. Error Bar = SEM. ∗∗∗ = p < 0.001. (E) HeLa cells were transfected with dynamin dominant-negative mutant (K44A) for 20 hr, loaded for 30 min with transferrin Alexa-555 and labeled for mATG9. The pictures show a re-localization of mATG9 from perinuclear locations to a more peripheral area of the cell (close to plasma membrane). (F and G) HeLa cells were RNA silenced for AP2 (μ2) for 5 days to inhibit clathrin-mediated endocytosis and treated as in (E). A control blot shows the level of AP2 (μ2) reduction (the arrow shows the AP2 (μ2) band). (H) HeLa cells transfected or not with empty pEGFP vector were processed for immunogold labeling on cryosections and labeled with anti-ATG9 antibody. The GFP protein is cytoplasmic and is not associated with clathrin-coated structures. This marker was used as negative control for the specificity of mATG9 localization on clathrin-coated structures. Error bar = SEM. (I) HeLa cells were fixed in basal conditions and processed for immunogold labeling on cryosections and stained with anti-mATG9 antibody. 10 cell profiles in two different experiments were considered by counting the number of gold particles (mATG9) in different compartments (PM: plasma membrane; CCS: clathrin-coated structures; END: endosomes; AS: autophagic structures; GOLGI: Golgi). The percentage of mATG9 localization in different compartments was quantified in the histogram and expressed as percentage of the total. Error bar = SEM. (J) The histogram shows the quantification expressed as Pearson’s Coefficient of the experiment shown in Figure 1 G. Error bar = SEM. ∗∗∗ = p < 0.001. (K) HeLa cells were fixed and labeled with EEA1 (early endosomes) and ATG16L1or mATG9. The Pearson’s Coefficient between EEA1 and ATG16L1 or mATG9 was quantified in the histogram. Error bar = SEM. ∗∗∗ = p < 0.001. (L) HeLa cells were transfected with GFP-RAB5 constitutively-active mutant (Q79L) for 20 hr and mStraw-ATG16L1, or transfected with GFP-RAB5 Q79L and labeled with anti-mATG9 antibody. This constitutively-active mutant induces aberrant fusion of early endosomes. The Pearson’s Coefficient between RAB5 Q79L and mATG9 or ATG16L1 was quantified in the histogram. Error bar = SEM. ∗∗∗ = p < 0.001.
Figure S2
Figure S2
ATG12 and ATG16L1 Localize in Recycling Endosomes, Related to Figure 2 (A) HeLa cells where transfected with GFP-RAB11 and labeled for ATG12 (the pictures show pseudo-colors). The amount of colocalization of ATG12 with RAB11 (recycling endosomes) is shown in the histogram expressed as Manders’ Coefficient. Error bar = SEM. (B) HeLa cells were transfected with pmStrawberry-ATG16L1 and pEGFP-RAB11. 20 hr later, the cells were fixed in basal conditions and stained for mATG9. The histogram shows the relative colocalization between RAB11-ATG16L1, RAB11-mATG9 and ATG16L1-mATG9 expressed as Manders’ Coefficient. Error bars = SEM.
Figure S3
Figure S3
Recycling Endosome Trafficking Regulates ATG16L1/mATG9 Vesicle Fusion, Related to Figure 3 (A) This figure shows the individual channels used for the composites in Figure 3H. (B) HeLa cells were transfected with HA-Q74 huntingtin and RAB11-EGFP or MVb tail-EGFP or EGFP empty vector constructs for 48 hr. The Q74 huntingtin aggregates were identified with anti-HA antibody. Error bar = SD from 3 different experiments. ∗∗∗ = p < 0.001; ∗∗ = p < 0.01. (C–E) This figure shows the individual channels (in negative to enable clear visualization of the vesicles) used for the composites in Figures 3J–3L. (F–G) HeLa cells were transfected with mCherry-RAB11 and pEGFP-ATG16L1 (F) or mStrawberry-ATG16L1 and EGFP-MVb tail (G). 5 movies of 5 min each movies were recorded each experiment. The histograms in F and G show the interactions (short and long-lived homotypic fusions) between ATG16L1 vesicles in control or RAB11- or MVb-overexpressing conditions. Error Bar = SEM. ∗∗∗ = p < 0.001. (H) HeLa cells were amino acid- and serum-starved for 4 hr (or maintained in full medium) and loaded for 30 min with transferrin Alexa-647. Unlabeled transferrin was then used to induce recycling for different times. The samples were then fixed wit 4% Paraformaldehyde and analyzed by FACS. The values in the graph represent the amounts of intracellular Tf—higher values correspond to less recycling. Error Bar = SD. Post hoc Test Anova < 0.05. (I) HeLa cells were transfected with pEGFP-ATG16L1. 5 movies of 5 min each were recorded in cells incubated with HBSS (starvation) or full medium. The histogram shows the homotypic interactions between ATG16L1 vesicles in control or starved cells. A minimum of 20 cells were examined each condition. Error Bar = SEM. ∗∗∗ = p < 0.001. See also Movies S3 and S4.
Figure S4
Figure S4
VAMP3 Depletion Affects Autophagy and Does Not Affect General Endocytosis, Related to Figure 5 (A) HeLa cells were transfected with oligos B (GGAUUACUGUUUCUGGUUAU) and C (GAGUUAACGUGGACAAGGU) for VAMP3, or with control oligo and blotted for LC3-II in presence (Baf A1) or absence of Bafilimycin A1 (basal). Tubulin was used as loading control. (B) HeLa cells transfected with control or VAMP3 siRNA (oligo A) for 4 days were subjected to immunocytochemistry for endogenous LC3. (C) HeLa cells were transfected for 20h with VAMP3-HA incubated 1 hr at 18°C or 37°C and labeled for endogenous ATG16L1. The colocalization at 18°C or 37°C is shown in Figure 5F. (D) HeLa cells transfected with control or VAMP3 siRNA were labeled for endogenous RAB11. E) HeLa cells treated with control or VAMP3 siRNA were loaded with transferrin Alexa-647 for different times (0, 2, 5, 10 and 15 min) or loaded for 30 min with transferrin Alexa-647, washed and incubated for different times (5, 10, 15 and 30 min) with unlabeled transferrin for the recycling assay. Error bar = SD. Loss of VAMP3 does not affect both transferrin uptake and recycling.
Figure S5
Figure S5
VAMP3 Depletion Affects ATG16L1/mATG9 Vesicle Fusion, Related to Figure 7 (A and B) HeLa cells transfected with control (A), VAMP3 siRNA (B) for 4 days were transfected for 20 hr with mStrawberry-ATG16L1 and ATG9L1-pEGFP. Representative images from 5 min Movies are shown. (See also Movies S5 and S6.)

Similar articles

See all similar articles

Cited by 151 PubMed Central articles

See all "Cited by" articles

References

    1. Ang A.L., Taguchi T., Francis S., Fölsch H., Murrells L.J., Pypaert M., Warren G., Mellman I. Recycling endosomes can serve as intermediates during transport from the Golgi to the plasma membrane of MDCK cells. J. Cell Biol. 2004;167:531–543. - PMC - PubMed
    1. Axe E.L., Walker S.A., Manifava M., Chandra P., Roderick H.L., Habermann A., Griffiths G., Ktistakis N.T. Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. J. Cell Biol. 2008;182:685–701. - PMC - PubMed
    1. Bonifacino J.S., Rojas R. Retrograde transport from endosomes to the trans-Golgi network. Nat. Rev. Mol. Cell Biol. 2006;7:568–579. - PubMed
    1. Fader C.M., Sánchez D.G., Mestre M.B., Colombo M.I. TI-VAMP/VAMP7 and VAMP3/cellubrevin: two v-SNARE proteins involved in specific steps of the autophagy/multivesicular body pathways. Biochim. Biophys. Acta. 2009;1793:1901–1916. - PubMed
    1. Galli T., Chilcote T., Mundigl O., Binz T., Niemann H., De Camilli P. Tetanus toxin-mediated cleavage of cellubrevin impairs exocytosis of transferrin receptor-containing vesicles in CHO cells. J. Cell Biol. 1994;125:1015–1024. - PMC - PubMed

Supplemental References

    1. Cadwell K., Liu J.Y., Brown S.L., Miyoshi H., Loh J., Lennerz J.K., Kishi C., Kc W., Carrero J.A., Hunt S. A key role for autophagy and the autophagy gene Atg16l1 in mouse and human intestinal Paneth cells. Nature. 2008;456:259–263. - PMC - PubMed
    1. Peden A.A., Schonteich E., Chun J., Junutula J.R., Scheller R.H., Prekeris R. The RCP-Rab11 complex regulates endocytic protein sorting. Mol. Biol. Cell. 2004;15:3530–3541. - PMC - PubMed
    1. Puri C. Loss of myosin VI no insert isoform (NoI) induces a defect in clathrin-mediated endocytosis and leads to caveolar endocytosis of transferrin receptor. J. Biol. Chem. 2009;284:34998–35014. - PMC - PubMed
    1. Puri C., Tosoni D., Comai R., Rabellino A., Segat D., Caneva F., Luzzi P., Di Fiore P.P., Tacchetti C. Relationships between EGFR signaling-competent and endocytosis-competent membrane microdomains. Mol. Biol. Cell. 2005;16:2704–2718. - PMC - PubMed
    1. Ravikumar B., Duden R., Rubinsztein D.C. Aggregate-prone proteins with polyglutamine and polyalanine expansions are degraded by autophagy. Hum. Mol. Genet. 2002;11:1107–1117. - PubMed

Publication types

Substances

LinkOut - more resources

Feedback