Insights into the initiation of JC virus DNA replication derived from the crystal structure of the T-antigen origin binding domain

Abstract

JC virus is a member of the Polyomavirus family of DNA tumor viruses and the causative agent of progressive multifocal leukoencephalopathy (PML). PML is a disease that occurs primarily in people who are immunocompromised and is usually fatal. As with other Polyomavirus family members, the replication of JC virus (JCV) DNA is dependent upon the virally encoded protein T-antigen. To further our understanding of JCV replication, we have determined the crystal structure of the origin-binding domain (OBD) of JCV T-antigen. This structure provides the first molecular understanding of JCV T-ag replication functions; for example, it suggests how the JCV T-ag OBD site-specifically binds to the major groove of GAGGC sequences in the origin. Furthermore, these studies suggest how the JCV OBDs interact during subsequent oligomerization events. We also report that the OBD contains a novel "pocket"; which sequesters the A1 & B2 loops of neighboring molecules. Mutagenesis of a residue in the pocket associated with the JCV T-ag OBD interfered with viral replication. Finally, we report that relative to the SV40 OBD, the surface of the JCV OBD contains one hemisphere that is highly conserved and one that is highly variable.

Figure 1. The structure of the JCV OBD. A

. The amino acid sequence of the JCV T-ag origin binding domain (OBD). The associated secondary structures are presented above the primary sequence. The positions of the A1, B2 and B3 motifs are indicated. B. A ribbon diagram of the JCV OBD crystal structure. The individual beta strands and alpha helices are indicated, as are the N and C termini. The individual secondary elements were named as previously described for the SV40 OBD . C. Superposition of all four structures of the JCV OBD (forms 1, 2 and 3), indicating where the DNA binding A1 and B2 loops are located along with the B3 motifs (in brown, blue and orange, respectively). Structurally, the most variable region in the OBD is the B3 motif.

Figure 2. The structure of the JCV T-ag OBD viewed in terms of residues that are identical conserved, or not conserved, with the SV40 T-ag OBD.

A. A comparison of the amino acid residues found in the OBDs from JCV (top) and SV40 (bottom). Identical residues are shown in blue, conserved residues in light pink and non-conserved residues in magenta. The locations of the DNA binding A1 and B2 loops are indicated as is the B3 motif; a region involved in T-ag oligomerization. The residue numbers for the JCV OBD are indicated above the amino acid sequence. B. Distribution of the identical, conserved and non-conserved residues on the two hemispheres of the JCV OBD. A surface representation of the JCV OBD is shown, it uses the coloring scheme described in A. The region containing the A1 and B2 motifs is circled. In addition, to establish the orientation of the domain, certain residues are labeled.

Figure 3. Modeling the interaction of the JCV OBD with the major groove in the Site II region of the core origin.

A. The DNA sequence of the Site II and Site I regions of the JCV origin of replication. The individucal GAGGC pentanucleotides are indicated. There is a single nucleotide difference between the SV40 and JC virus Site II that was previously shown not to influence T-ag binding . B. Comparison of the SV40 OBD structures in the absence and presence of DNA (magenta and yellow structures, respectively) with the DNA free form of the JCV OBD (in cyan). Note the position of SV40 OBD residue F151; based on this superposition, the A1 loop in the JCV OBD structure is in the “apo-conformation.” C. Superposition of four JCV OBDs onto the SV40 OBDs bound to the four pentanucleotides in Site II (PDB code 2ITL). A translucent surface representation of the SV40 T-ag OBDs is shown. The locations of the N and C termini are indicated, as are the locations of pentanucleotides P1-P4. Shown as yellow spheres is the position of SV40 T-ag OBD residue F151. The insert shows a close up view of the JCV OBD residue F152 in the major groove and the corresponding residue in the SV40 OBD (i.e., F151) when bound to DNA. This model, indicates that upon interacting with GAGGC sequences in a site-specific manner, the F152 containing A1 motif in the JCV OBD undergoes a structural rearrangement.

Figure 4. Determining the affinity of the JCV OBD for oligonucleotides containing the Site II and Site I regions of the viral origin.

A. Results from ITC studies conducted with the JCV T-ag OBD and a 33 bp Site II based oligonucleotide. (The protein concentration in the syringe was ∼80 uM, the Site II containing oligonucleotide was used at a concentration of 1.5 uM). The Site II based oligonucleotide used in this experiment was 5′ TACAGGAGGCCGAGGCCGCCTCCGCCTCCAAGC 3′ and its complement. The calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated. The X- axis is time in minutes, while the Y axis of the isotherm is power in ucal/s. These values were determined following curve fitting of the integrated calorimetric trace presented in the bottom panel. B. Results from ITC studies conducted with the JCV OBD and a 28 bp Site I oligonucleotide. (The protein concentration in the syringe was 40 uM, the Site II containing oligonucleotide was used at a concentration of 1.0 uM). The Site I based oligonucleotide used in this experiment was 5′ GCGTGGAGGCTTTTTAGGAGGCCAGGGA 3′ and its complement. As in panel A, the calorimetric trace is shown in the top panel; the Kd and stoichiometry (N) values are indicated.

Figure 5. Modeling the interaction of the JCV OBD with Site I.

A. Presented in panel A is the actual co-structure of the SV40 T-ag OBD on Site I . A translucent surface representation of the SV40 T-ag OBDs is shown, indicating that no protein/protein interactions were observed in this crystal structure. The positions of pentanucleotides P5 and P6 are indicated. Note, in contrast to Site II, the pentanucleotides in Site I are arranged in a head-to-tail orientation . Steric clashes between the OBDs were not detected. The yellow balls indicate the positions of SV40 T-ag OBD residue F151. B. A superposition of the JCV OBDs (cyan) onto the SV40 T-ag OBDs (yellow) while bound to Site I (PDB code 4FGN). A translucent surface representation of the JCV T-ag OBDs is presented. Steric clashes occur, an indication that structural rearrangements are likely to take place. Residues that are predicted to clash are shown in the insert.

Figure 6. The dimer that represents the asymmetric unit in crystal form 1 of the JCV OBD.

A. The dimer present in crystal form 1 of the JCV OBD; the positions of monomers A and B are indicated. The purple residues are from the A1 and B2 motifs in monomer A, while the orange residues are from the C-terminal pocket in monomer B. The arrows symbolize that the A and B subunits interact at an approximetly 95 degree angle. B. Separation of the dimer to reveal the A1 and B2 motifs (in purple) and the C-terminal pocket (in orange). C. The calculated electrostatic potential of the JCV OBD was mapped to the surface of the molecule and color-coded using a sliding scale from −10 to +10 (in units of kB T/e). Red represents negative electrostatic potential, blue positive electrostatic potential and white is neutral. This view of the A1 and B2 motifs and C-terminal pocket emphasizes their electrostatic complementarity. D. Residues forming the interface between monomers A and B. The interface includes those from the A1 (i.e., Q149 - R155) and B2 (i.e., R205 - A208) regions of OBD monomer A interacting with residues from monomer B including the C-terminus (i.e., L253 - N259) and those from various loops (e.g., A158, T183, T200 and P201). Hydrogen bonds are indicated by solid blue lines. Non-bonded contacts are indicated by dashed orange lines; the width is proportional to the contribution of the interaction. Finally, those residues that are common to the interfaces formed by the SV40 and JCV OBDs are shaded yellow.

Figure 7. The novel pocket present in the JCV OBD.

A. Two views of the newly identified pocket present in the JCV OBD; residues lining the pocket are shown in orange. Pocket residue F258 is colored in purple. B. A model depicting the relative position of the pocket on a JCV OBD site-specifically bound to the major groove of duplex DNA.

Figure 8. The higher order structures present in the JCV T-ag OBD crystals.

A. Two views of the right handed tetrameric crystallographic spiral formed by the JCV T-ag OBD. B. Superimposition of crystal forms 2 and 3 and their relevant symmetry mates on crystallographic spiral of form 1. The JCV T-ag OBDs in crystal form 1 are colored, while those in crystal forms 2 and 3 are in gray. C. Contrasting the structures formed by the JCV and SV40 T-ag OBDs. The JCV OBDs interact at an approximately 90 degree angle, while the SV40 OBDs interact at a 60 degree angle . Regarding the translational component, for the SV40 hexameric spiral the rise is ∼6 Å per OBD pair. In contrast, for the tetrameric JCV OBD structures the rise is ∼9 Å per OBD pair (thus both spirals have an overall rise of 36 Å). Consequences of the greater rise seen in the JCV OBD structure include the smaller central channel and the “tighter” spiral observed in the current structures (Fig. 8A).

Figure 9. The results of DNA replication studies conducted with full-length JCV T-ag's containing mutations at selected locations.

A. Relative replication levels of reactions conducted with wild type (wt) JCV T-ag and the Q240A and F258L mutants. The assays (materials and methods) were conducted 72 hrs. post-transfection. B. The results of Western Blots used to monitor the levels of the different forms of JCV T-ag in C33A cells at 72 hrs post-transfection. Vinculin levels were determined as a loading control.