Disruption of polycystin-L causes hippocampal and thalamocortical hyperexcitability

Abstract

Epilepsy or seizure disorder is among the least understood chronic medical conditions affecting over 65 million people worldwide. Here, we show that disruption of the polycystic kidney disease 2-like 1 (Pkd2l1 or Pkdl), encoding polycystin-L (PCL), a non-selective cation channel, increases neuronal excitability and the susceptibility to pentylenetetrazol-induced seizure in mice. PCL interacts with β2-adrenergic receptor (β2AR) and co-localizes with β2AR on the primary cilia of neurons in the brain. Pkdl deficiency leads to the loss of β2AR on neuronal cilia, which is accompanied with a remarkable reduction in cAMP levels in the central nervous system (CNS). The reduction of cAMP levels is associated with a reduction in the activation of cAMP response element-binding protein, but not the activation of Ca(2+)/calmodulin-dependent protein kinase II, Akt or mitogen-activated protein kinases. Our data, thus, indicate for the first time that a ciliary protein complex is required for the control of neuronal excitability in the CNS.

Figure 1.

PCL localizes to the primary cilia of neuronal cells in the brain. (A) Confocal imaging indicates PCL expression in the neuronal cells in the cerebral cortex, hippocampus and thalamus. (B) PCL localizes to the primary cilia of hippocampal neurons in a primary culture. (C) PCL localizes to the AC8⁺ neuronal primary cilia in the mouse cortex and hippocampus. Insets show the cilia indicated by arrows. PCL was stained by antibody 83430. Neurons were detected by neuronal marker NeuN. AC3 was used to mark neuronal primary cilia. AC8 is a new neuronal cilium marker identified in this study.

Figure 2.

Pkdl^−/− mice are sensitive to PTZ. (A) Targeting strategy for Pkdl and restriction map of the Pkdl gene. The solid boxes represent the exons of the Pkdl gene and the interconnecting lines indicate introns. The probe used for Southern blotting is shown as a bar. (B) Southern blot analysis of mouse tail DNA. The 3.2 and 4.8 kb bands represent the germ-line and targeted allele, respectively. (C) RT-PCR analysis of total RNA extracted from mouse brains using primers mPcLf605 5′ACACAGCCGAGAACAGGGAGCTT3′ and mPcLr611 5′ GCATACGTGTCTGGCTGTTGCAG3′. No normal Pkdl mRNA was detected in the brains of adult Pkdl^−/− mice by RT-PCR analysis, but a truncated Pkdl mRNA was present. M, 100 bp DNA marker. (D) Immunoblotting analysis of the PCL protein. Anti-PCL antibody is specific for the N-terminal portion of the PCL protein. Testis extracts from Pkdl^+/+, Pkdl^+/− or Pkdl^−/− mice were immunoprecipitated with anti-PCL and immunoblotted with the same antibody. PCL protein was not detected in Pkdl^−/− mice. (E) The severity of seizure increases in KO mice when compared with WT mice (PTZ = 40 μg/g). 0: no response; 1: isolated twitches; 2: tonic-clonic convulsions; 3: tonic extensions and/or death. (F) Latency in KO mice is reduced compared with WT littermates (PTZ = 50 μg/g).

Figure 3.

LFP recordings suggest a loss of control of excitability in Pkdl^−/− mice. (A) Under ketamine–xylazine anesthesia, EEG recording of spontaneous activity from neocortex (Cx-1, -2 and -3), hippocampus (Hip) and thalamus (Thal) showed the slow oscillation (WT = 0.6 Hz; KO = 0.4 Hz) synchronized among the three structures as shown in the average (AVG, n = 20 cycles) centered on negative peaks of Cx-1. KO showed high-amplitude spikes. (B) Responses to thalamic stimulation of ventrobasal (VB) nucleus of the thalamus. (C) Seizure threshold is lower in KO mice. PTZ (40 μg/g) triggered mild spike–wave seizures in WT mice (n = 6), while KO mice (n = 10) showed severe tonic-clonic seizures.

Figure 4.

cAMP is reduced in Pkdl^−/− mouse brain tissues. (A) The cAMP levels in adult Pkdl^−/− mouse brains were reduced by ∼27% compared with the WT littermates. (B) Consistently, western blot revealed that pCREB^S133 was also significantly reduced in the same brain tissues. (C) The pCREB^S133 protein levels were normalized to total CREB protein in each brain tissue. The WT brain tissues were set at 100%, as reference. Error bars represent standard deviation (n = 5). The significance was calculated by Student's t-test (P < 0.01). Three independent experiments were performed. (D) There were no obvious changes in phosphorylation of CaMKII, Akt or MAPK in Pkdl^−/− brain tissues compared with WT mice.

Figure 5.

PCL interacts with β2AR and is required for ciliary localization of β2AR in neurons. (A) β2AR expression on cilium-like structures in hippocampus was remarkably diminished in the KO neurons. (B) β2AR co-localizes with AC8 on the neuronal primary cilia in the dentate gyrus of hippocampus. Cilia from two neighboring cells are shown in insets. (C) PCL and β2AR co-immunoprecipitated each other in HEK293T cells stably expressing PCL-Myc in a tetracycline inducible manner and transiently expressing Flag-β2AR. (D) Reciprocal co-immunoprecipitation of endogenous PCL and β2AR from mouse hippocampal lysates using respective antibodies. (E) PCL co-localizes with β2AR on the neuronal primary cilia in hippocampus. Insets show a cilium indicated by arrows. (B and E) Confocal images.

Figure 6.

A schematic model of PCL and β2AR localization to the neuronal primary cilia and their interaction. The PCL–β2AR protein complex regulates the cAMP levels and neuronal excitability in the CNS.