Design of a molecular support for cryo-EM structure determination

Abstract

Despite the recent rapid progress in cryo-electron microscopy (cryo-EM), there still exist ample opportunities for improvement in sample preparation. Macromolecular complexes may disassociate or adopt nonrandom orientations against the extended air-water interface that exists for a short time before the sample is frozen. We designed a hollow support structure using 3D DNA origami to protect complexes from the detrimental effects of cryo-EM sample preparation. For a first proof-of-principle, we concentrated on the transcription factor p53, which binds to specific DNA sequences on double-stranded DNA. The support structures spontaneously form monolayers of preoriented particles in a thin film of water, and offer advantages in particle picking and sorting. By controlling the position of the binding sequence on a single helix that spans the hollow support structure, we also sought to control the orientation of individual p53 complexes. Although the latter did not yet yield the desired results, the support structures did provide partial information about the relative orientations of individual p53 complexes. We used this information to calculate a tomographic 3D reconstruction, and refined this structure to a final resolution of ∼15 Å. This structure settles an ongoing debate about the symmetry of the p53 tetramer bound to DNA.

Keywords: DNA-origami; cryo-EM; p53; single particle analysis; structural biology.

Fig. 1.

Design of the support structure. (A) Perspective view of the support structure. Each dsDNA helix is shown as a white cylinder. The position of the specific binding sequence on the central dsDNA helix is shown in red; ssDNA overhangs (T₁₀) are shown in blue. (B) Top view of the support structure. Inner and outer dimensions of the support structure are shown in gray. The dimensions of the asymmetric feature (flag) are shown in green. (C) Side view of the support structure. (D) Illustration of five different settings for the p53-specific binding sequence on the central dsDNA helix. A surface representation of the tetrameric DBD of p53 is shown in red. In each representation, the p53-binding site is shifted one base upward from left to right. Because of the helical nature of the dsDNA, this shift also results in a rotation of the p53 complex.

Fig. S1.

Orientation of DNA-origami structures in ice. (A) Different views of a DNA-origami object. (B) Micrograph of the DNA-origami object showing mainly front views (i.e., similar to A, Top), where the DNA helices of origami object are located perpendicular to the air–water interface.

Fig. 2.

Image-processing strategy. (Scale bars: 20 nm.) (A) Part of a typical micrograph. A template for automated particle picking is shown in the top right corner. (B) Tomographic side view of a hole showing a monolayer of support structures. Near the edge of the hole (indicated with an arrow), the ice gets slightly thicker. (C) Examples of 2D classes that are discarded. (D) Examples of 2D classes of intact structures with the flag in the top left or top-right. A mirror operation is applied to images with the flag on the top right. (E) The average of all intact particles with the correct orientation in ice, including the mirrored particles, is used as a template for their alignment. (F) Subimages (cyan) with a width and height of 20 nm are extracted from the aligned particles and submitted to 2D classification with a prior on the in-plane rotation. A circular mask that is applied during this process is shown in yellow. Three types of particles are distinguished: supports without tilt axis (F, Top), supports with tilt axis but without a density for p53 (F, Middle), and supports with tilt axis and p53 density (F, Bottom). (G) Illustration of the final selection of particles, where the angle from a realignment of the p53-only subimage is compared with the angle of the entire support structure, and particles with large differences in these angles (e.g., Lower) are discarded.

Fig. S2.

Distribution of DNA origami supports. (A) Overview image of the holes as seen when collecting data and choosing a hole to take an image in. (B) Red area shown in A. (C) Blue area shown in B. (D–F) Sample micrograph showing good distribution of particles where the ice is the right thickness, random orientations where it gets too thick, and no particles where it gets too thin.

Fig. 3.

Initial model generation and final maps. (A) Class averages used for the initial model generation sorted by tilt axis setting. An illustration of the designed orientation is shown on the left, and the applied tilt angle is shown in front of the class averages. (B) Initial model reconstructed with the expected tilt angles in C1. The angles for rot and psi were all set to 0°. In RELION, the first rotation of the 3D reference object (rot) is around the z axis, which comes out of the xy plane of the figure; the second rotation (tilt) is around the new y axis, and the third rotation (psi) is around the new z axis. B, Inset shows a simplified explanation of these rotations from the point of view of the experimental particles. In that case, psi is the in-plane rotation, tilt is the rotation around the central DNA axis, and rot describes out-of-plane rocking. (C) The same model as in B with C2 symmetry imposed. The twofold symmetry axis is along the z axis and is indicated with an oval. (D) Map after realignment of the class averages with 5° priors on the rot and psi angles and unrestricted tilt angles. (E) Different views of the final map generated from 9,271 particles. The estimated resolution is ∼15 Å. Protein Data Bank model 4HJE (35) of the DBD in blue. (F) Histogram of the refined tilt angles for each of the tilt axis settings.

Fig. S3.

Refinements with different prior schemes. Front and back views are shown of reconstructions from refinements where no priors were imposed on any angles (first column), 5° priors were imposed on either psi or rot (second and third columns, respectively), on both rot and psi (fourth column), or on both rot and psi combined with a 15° prior on tilt (fifth column). For each refinement, histograms of the resulting tilt, rot, and psi angles are shown for each of the tilt-axis settings (blue, −2 bp; cyan, −1 bp; green, 0 bp; orange, +1 bp; red, +2 bp).

Fig. S4.

Refinements with progressively loose priors on psi and rot. Front and back views are shown of reconstructions from refinements where progressively less informative (i.e., broader) priors were imposed on the rot and psi angles. The tilt angles were unrestrained in all refinements.

Fig. S5.

Attachment of the dsDNA tilt-axis in the support structure. Blue shows the scaffold and gray/red the tilt axis. The binding site for p53 is shown in red (central tilt axis). The sequences for the tilt axis with the binding site in the center are: 1, ATCGCGCACCAGACGACTGGGCCTCAGTGTCGGACATGTCCGGACATGTCCGAGCATGAGGCGGGCGAGCACTCCCCGCCTC; 2, CCGTTCCCGCCAGGGTTGGGGCCTCATGCTCGGACATGTCCGGACATGTCCGACACTGAGGCAGCGTCAGAATGATATTAAT; 3, …ATTAATA…TCATTCT…GACGCTATCCAGTC…GTCTGGT…GCGCGAT….; 4, …GAGGCGG…GGAGTGC…TCGCCCTTCCCAAC…CCTGGCG…GGAACGG…

Fig. S6.

Cadnano design diagram of the support structure. Scaffold strand is depicted with blue lines. Staples are colored by purpose. Gray, core structure oligos; cyan, 10xT passivation oligos; orange/red, tilt axis oligos; black, outside loops.