Conserved binding of GCAC motifs by MEC-8, couch potato, and the RBPMS protein family

Abstract

Precise regulation of mRNA processing, translation, localization, and stability relies on specific interactions with RNA-binding proteins whose biological function and target preference are dictated by their preferred RNA motifs. The RBPMS family of RNA-binding proteins is defined by a conserved RNA recognition motif (RRM) domain found in metazoan RBPMS/Hermes and RBPMS2, Drosophila couch potato, and MEC-8 from Caenorhabditis elegans In order to determine the parameters of RNA sequence recognition by the RBPMS family, we have first used the N-terminal domain from MEC-8 in binding assays and have demonstrated a preference for two GCAC motifs optimally separated by >6 nucleotides (nt). We have also determined the crystal structure of the dimeric N-terminal RRM domain from MEC-8 in the unbound form, and in complex with an oligonucleotide harboring two copies of the optimal GCAC motif. The atomic details reveal the molecular network that provides specificity to all four bases in the motif, including multiple hydrogen bonds to the initial guanine. Further studies with human RBPMS, as well as Drosophila couch potato, confirm a general preference for this double GCAC motif by other members of the protein family and the presence of this motif in known targets.

Keywords: ITC; NMR; X-ray crystallography; protein–RNA; structure.

FIGURE 1.

Characterization of MEC-8 RRM1 dimer and ligand sequence. (A) RNA recognition motif (RRM) domains within C. elegans MEC-8 (UniProt G5ECJ4), Drosophila melanogaster couch potato (CPO; UniProt Q01617), human RBPMS (UniProt Q93062), and human RBPMS (UniProt Q6ZRY4). Residue numbers are indicated. Note that all four proteins exist as multiple splice isoforms, with only the N-terminal RRM domain common to all MEC-8, couch potato, and RBPMS variants. (B) Sequence alignment of the conserved RRM domain of the RBPMS family. Regions of β-strands (black arrows) and α-helices (white cylinders) are indicated above the MEC-8 sequence, based on the crystal structure of the unbound MEC-8 RRM1 domain. Residues involved in dimerization are indicated with asterisks. Residue sidechains involved in ligand binding are indicated with a black circle, and interactions with backbone atoms have a white circle. Identical residues in all four sequences are highlighted in black and those that are homologous by sidechain properties are shaded in gray. (C) NMR spectroscopy characterization based on residue-specific ¹⁵N relaxation measurements of T1 (light green), T2 (purple), the combined ratio of T1/T2 and {¹H}¹⁵N heteronuclear NOE. Predicted values of monomeric and dimeric RRM1 are indicated by dashed and solid lines, respectively (Daragan and Mayo 1997). Values of {¹H}¹⁵N heteronuclear NOE below 0.6 correspond to backbone amides with significant conformational disorder. (D,E) Structure overview and close-up of the dimerization interface of the unbound MEC-8 RRM1 dimer (PDB 5BJR). (F) Relative affinity of ligands with individual nucleotide substitutions binding to MEC-8 RRM1 by using isothermal titration calorimetry (ITC). The heights of the A, C, G, and U in each position are relative to the determined values of the association constant, K_A. Representative raw data and derived K_A values can be found in Supplemental Figure S2. (G) Representative data from ITC measurements of MEC-8 RRM1 with the RNA ligands AGCACA and AGCACAUUUUUUAGCACA.

FIGURE 2.

Molecular basis of GCAC recognition by MEC-8 RRM1. (A) Side view of the MEC-8 RRM1_(28–117) dimer bound to AGCACATTTTTTTTAGCACA (PDB 5TKZ). (B) Summary of hydrogen bonds between each MEC-8 RRM1 domain with the nucleotide ligand. Shared hydrogen bonds are indicated with black dotted lines. Hydrogen bonds specific to the first or second GCAC are indicated with orange or brown lines, respectively. (C) Common molecular recognition of the CAC trinucleotide by MEC-8 RRM1_(28–117) (orange; chain B) and RBPMS (magenta; chain A of PDB 5DET) (Teplova et al. 2016). Hydrogen bonds are shown as dashed lines. (D) Close-up of the molecular details of guanine binding by MEC-8 and the uracil binding by RBPMS, colored as in C. (E) RNA binding affinity measured by isothermal titration calorimetry (ITC) for C. elegans MEC-8 RRM1, D. melanogaster couch potato_(447-543), and human RBPMS_(11–111) normalized for each protein by the K_D of the 6-mer, and with error as the root mean square deviation.