Piriformospora indica Reprograms Gene Expression in Arabidopsis Phosphate Metabolism Mutants But Does Not Compensate for Phosphate Limitation

Abstract

Piriformospora indica is an endophytic fungus of Sebacinaceae which colonizes the roots of many plant species and confers benefits to the hosts. We demonstrate that approximately 75% of the genes, which respond to P. indica in Arabidopsis roots, differ among seedlings grown on normal phosphate (Pi) or Pi limitation conditions, and among wild-type and the wrky6 mutant impaired in the regulation of the Pi metabolism. Mapman analyses suggest that the fungus activates different signaling, transport, metabolic and developmental programs in the roots of wild-type and wrky6 seedlings under normal and low Pi conditions. Under low Pi, P. indica promotes growth and Pi uptake of wild-type seedlings, and the stimulatory effects are identical for mutants impaired in the PHOSPHATE TRANSPORTERS1;1, -1;2 and -1;4. The data suggest that the fungus does not stimulate Pi uptake, but adapts the expression profiles to Pi limitation in Pi metabolism mutants.

Keywords: PHT1; Piriformospora indica; WRKY6; phosphate starvation; root expression profiles.

FIGURE 1

Total number of differentially regulated genes which responded to Piriformospora indica in the roots of WT or wrky6 seedlings grown on either NP or LP. The black numbers show all genes regulated more than 2-fold in the roots of WT or wrky6 seedlings grown on either NP or LP media. Common genes among the two datasets are in red. Thirteen genes are common to all datasets. For specific genes, see data submitted to NCBI.

FIGURE 2

PageMan analysis of differentially expressed genes (>2-fold) by P. indica in WT or wrky6 roots grown on either NP or LP. Scale depicts level of expression with blue being high and red being low. Only significantly regulated (p-value <0.05) categories are shown. Numbers on the right refer to the categories defined by the PageMan program, which are presented in Supplementary Table S1. For specific genes, see data submitted to NCBI. For more detailed information on the program, cf. the MapMan software at http://mapman.gabipd.org/web/guest/mapman.

FIGURE 3

GO annotations of the genes which are differentially regulated (>2-fold) by P. indica in WT or wrky6 roots grown on either NP or LP. For specific genes, see data submitted to NCBI.

FIGURE 4

Homozygosity test for pht1;1, pht1;2, and pht1;4 by PCR. Only one plant per knock-out line is shown. The gene-specific primers LP (left primer) and RP (right primer) amplify the expected fragments for the PHT1;1, PHT1;2, and PHT1;4 genes in DNA preparations from WT plants, which is used as a positive control. The T-DNA specific primer LBb1.3 (TGGTTCACGTAGTGGGCCATCG) in combination with the gene-specific RPs (cf. Supplementary Table S1) amplifies a PCR fragment only when the T-DNA is inserted into the respective gene close to the RP. The PCR samples were run on a 1% agarose gel next to a size ladder and the predicted sizes of the fragments were confirmed.

FIGURE 5

The effect of P. indica on the fresh weights (A,B) and Pi content (C) of WT and pht1 mutant seedlings grown on NP and LP medium. Seedlings were transferred to PNM medium with either NP or LP and with or without P. indica and the shoots and roots were harvested separately after 2 weeks. Based on five independent co-cultivation experiments with 60 seedlings per treatment and genotype. Bars represent SEs.

FIGURE 6

Phenotype of WT and pht1;1 pht1;4 seedlings/plants. Top: After 10 days, WT and pht1;1 pht1;4 seedlings were transferred to PNM medium with NP for 3 weeks. Bottom: Arabidopsis WT (upper 4 plants) and pht1;1 pht1;4 double knock-out lines (lower 4 plants) were grown in Petri dishes for 10 days before transfer to soil for additional 4 weeks. Growth occurred in a greenhouse.

FIGURE 7

Piriformospora indica promotes the efficiency of the photosynthetic electron transport of the double knock-out line exposed to high light stress under Pi limitation. Chlorophyll fluorescence measurements (Fv/Fm) for P. indica-exposed WT and pht1;1 pht1;4 seedlings which were transferred to fresh PNM plates with LP and high light intensity (300 μmol m^-2 s^-1) for 1 week (cf. Materials and Methods). Based on three independent experiments with 16 plants each. Bars represent SEs.