Spatiotemporal segregation of human marginal zone and memory B cell populations in lymphoid tissue

Abstract

Human memory B cells and marginal zone (MZ) B cells share common features such as the expression of CD27 and somatic mutations in their IGHV and BCL6 genes, but the relationship between them is controversial. Here, we show phenotypic progression within lymphoid tissues as MZ B cells emerge from the mature naïve B cell pool via a precursor CD27^-CD45RB^MEM55+ population distant from memory cells. By imaging mass cytometry, we find that MZ B cells and memory B cells occupy different microanatomical niches in organised gut lymphoid tissues. Both populations disseminate widely between distant lymphoid tissues and blood, and both diversify their IGHV repertoire in gut germinal centres (GC), but nevertheless remain largely clonally separate. MZ B cells are therefore not developmentally contiguous with or analogous to classical memory B cells despite their shared ability to transit through GC, where somatic mutations are acquired.

Fig. 1

Deep immunophenotypic profiling of B cells in human tissues. a viSNE projections of the B cell compartment in tissues (GALT n = 8; tonsil n = 5, spleen n = 6). Data were clustered according to criteria used to define known B cell subsets: CD27, CD24, CD28, CD10, IgM, IgD, IgA, IgG and HLA-DR. b Key to B cells subsets identified in the SPADE plots in c that were created for each tissue to enable comparisons of their compositions. Expression of CD27, IgM and IgD are illustrated. d Visualisation of the expression of CD45RB in B cell subsets when CD45RB was not one of the clustering criteria. Arrows identify the location of CD45RB⁺ cells in the naïve B cell SPADE bubble

Fig. 2

CD27⁻IgM⁺IgD⁺CD45RB⁺ marginal zone precursor B cells emerge from the naïve B cell pool. Analysis of B cells in GALT (n = 8); tonsil (n = 5), spleen (n = 6). a Z-score outcomes of a permutation test to determine if cell subpopulations significantly neighbour each other more than by random chance. This revealed that the CD45RB⁺ cells were significantly different to the CD45RB^- cells within the naïve B cell SPADE bubble by their over expression of CD24, IgM, CD45 in addition to CD45RB and lower expression of BCMA, HLA-DR, IgD and CD38. b A SPADE bubble was therefore placed around the CD27⁻CD45RB⁺ cells to be considered as a separate subset for inclusion in subsequent analysis, as illustrated for spleen. c All subsets (GC germinal centre, PB plasmablasts, TS transitional cells) were then visualised back on the viSNE plots for comparison where CD27⁻IgM⁺IgD⁺CD45RB⁺ cells were intermediate between naïve and CD27⁺IgM⁺IgD⁺ marginal zone subsets. d A separate hierarchical clustering method that considered all markers used for mass cytometry aligned CD27⁻IgM⁺IgD⁺CD45RB⁺ cells with CD27⁺IgM⁺IgD⁺ marginal zone cells and placed both closer to the naïve and transitional B cell subsets than conventional memory compartments

Fig. 3

Comparison of B cell subsets between tissues. Analysis of B cells in GALT (n = 8); tonsil (n = 5), spleen (n = 6). a, b Pie charts illustrate that tissues contained different relative frequencies of B cell subsets. The numbers inside the donut charts are the percentages of total B cells in that tissue represented in the donut. c Heatmap of median expression of β7 integrin and CCR7 in SPADE bubbles from each tissue indicating biases in migratory potential. d Heatmap of median expression of CD21, CD180, CD69, CD80 and FcRL4 showing that the same subset in different tissues can differ markedly in its surface antigen expression

Fig. 4

Marginal zone and class switched memory B cells occupy different microanatomical niches. a Visualisation of microanatomy of human appendix by imaging mass cytometry. A representative example of appendix from three different donors studied. CD3 (T cells; green), CD20 (B cells; magenta), CD86 (dendritic cells; cyan) and keratin (epithelium; red). Scale bar represents 100 μm. b Conventional mixing of fluorochromes did not enable the identification of B cell subsets that require multiple markers. The combination of CD27 (green), CD45RB (blue), CD20 (magenta) and IgD (cyan) would require the further addition of IgM for the detection of marginal zone B cells and their putative precursors. c Pixels with signal representing CD19⁺CD20⁺CD27⁺IgM⁺IgD⁺ of MZ B cells are green (approximate population boundary marked with a green dotted line). Pixels with signal representing CD19⁺CD20⁺CD27⁺IgM⁻IgD⁻ class switched memory (CSM) cells are magenta (approximate population boundary marked with a magenta dotted line). Importantly, pixels representing MZ and class switched memory have different distributions. Pixels with signal representing CD19⁺CD20⁺CD10⁺IgD⁻ of germinal centre (GC) cells are cyan (circled by a cyan dotted line). In addition, pixels representing CD19⁺CD20⁺CD27⁻IgM⁺IgD⁺ naïve B cells are yellow and pixels representing naïve cells are also illustrated as inserts. The epithelium is red. d An enlargement of the area of c. identified by the white rectangle. Pixel detail of the zones encircled by coloured dotted lines is illustrated in e–g. h Expression of FcRL4 in human appendix in red. Pixels with signal representing CD19⁺CD20⁺CD27⁺IgM⁺IgD⁺ of MZ B cells are blue. Expression of FcRL4 by MZ B cells is visualised as magenta pixels in i and j. Pixels with signal representing CD19⁺CD20⁺CD27⁺IgM⁻IgD⁻ class switched memory cells are green and so expression of FcRL4 by class switched memory cells is visualised as yellow pixels on FcRL4+ cells in k and l. FcRL4+ cells can therefore be either MZ or class switched memory cells

Fig. 5

Dissemination of B cell clones through human gut. Analysis of B cells from three anatomical sites from each of four tissue donors. a Hierarchical clustering of isotype-specific B cell clones at different sites in the gut and blood. Each row represents a single clone, and columns represent site-isotype combinations. The grayscale represents the log₁₀ transformed number of unique sequences in each clone. The hierarchical clustering is based on a distance function that quantifies that extent of shared clones across site-isotype combinations, and is shown on the top of the heatmap as a dendrogram. b–d Lineage trees showing dispersed clones of predominantly single isotype comprised of IgA (diamonds), IgM (stars) and IgG (squares). Recombining segments and junctional sequence of the most recent common ancestor (MRCA) of the clones are: b IGHV3-30, IGHJ4*02 TGTGCGAAAAAGGTTGSGGGAGGTCCGAAAACAGAAG GGGTTGACTACTGG. c IGHV3-23, IGHJ4*02 TGTGCGAAAGGTAGCGGGTCRKCTCGCCCGTACTACTTTGACTACTGG. d IGHV5-51*01, IGHJ3*02 TGTGCGAGACTTGACGGTAGCAGCAGTACTGATTGTCTTGATATYTGG

Fig. 6

Clonal dissemination of B cell subsets. Analysis of B cells from three different sites from each of four tissue donors (a) Circos plots showing the clonal relationships between B cells in the gut and CD27⁺IgM⁺ subsets and CD27⁺IgA⁺ cells in blood for Donors 1–4. Sequences clonally related across tissue-isotype-subset are connected by lines, with sequences spanning gut CD27⁺IgM⁺IgD⁺ and gut CD27⁺IgM⁺IgD⁻ subsets coloured green and blue, respectively. All other connections are coloured light grey. b Numbers and percentages illustrating distribution of clone members (top triangles) and unique sequences (bottom triangles) from B cell subsets across different sites sampled. c Lineage tree depicting a shared lineage of blood and GALT CD27⁺IgM⁺IgD⁺ cells. Recombining segments of the clone were IGHV5-51*01, IGHJ4*02, junctional sequence TGTGCGAGACACGAGATGGAAGTGGCTGGTGCT TACCTTGGCTTCTGG

Fig. 7

CD27⁺IgM⁺IgD⁺ cells diversify their receptors in gut GC. a, b Lineage trees including clone members isolated from GC of GALT, CD27⁺IgM⁺IgD⁺ cells from GALT and in (b) also CD27⁺IgM⁺IgD⁺ cells from blood. CD27⁺IgM⁺IgD⁺ cells before and after the GC phase were identified, indicating that the response is current and dynamic and generating cells enter and exit the GC response with the same (CD27⁺IgM⁺IgD⁺) phenotype. CD27⁺IgM⁺IgD⁻ clone members can also be identified. Recombining segments and junctional sequences of the MRCA of the clones are: a, IGHV3-33, IGHJ4*02 TGTGCGAGAGGGATCAA CTACGGTGACGCCGACGGCTTT GACAACTGG. b, IGHV5–10*01, IGHJ4*02 TGTGCGAGACATTTTGGGCACTACTTTGACTACTGG

Fig. 8

Analysis of B cells from three different sites from each of four tissue donors. Percentage of sequences with clonal relatives shared between CD27⁺IgM⁺IgD⁺ and CD27⁺IgM⁺IgD⁻, CD27⁺IgA⁺ and CD27⁺IgM⁺IgD⁻ subsets and CD27⁺IgA⁺ and CD27⁺IgM⁺IgD⁺ subsets, within and between sites. Numbers in blocks indicate the percentage of shared sequences within or between sites, with darker shading indicating increased sharing