Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Review
, 10, 987
eCollection

The M 6 A Dynamics of Profilin in Neurogenesis

Affiliations
Review

The M 6 A Dynamics of Profilin in Neurogenesis

Antonio L Rockwell et al. Front Genet.

Abstract

Our understanding of the biological role of N 6-methyladenosine (m6A), a ubiquitous non-editing RNA modification, has increased greatly since 2011. More recently, work from several labs revealed that m6A methylation regulates several aspects of mRNA metabolism. The "writer" protein METTL3, known as MT-A70 in humans, DmIme4 in flies, and MTA in plants, has the catalytic site of the METTL3/14/16 subunit of the methyltransferase complex that includes many other proteins. METTL3 is evolutionarily conserved and essential for development in multicellular organisms. However, until recently, no study has been able to provide a mechanism that explains the essentiality of METTL3. The addition of m6A to gene transcripts has been compared with the epigenetic code of histone modifications because of its effects on gene expression and its reversibility, giving birth to the field of epitranscriptomics, the study of the biological role of this and similar RNA modifications. Here, we focus on METTL3 and its likely conserved role in profilin regulation in neurogenesis. However, this and many other subunits of the methyltransferase complex are starting to be identified in several developmental processes and diseases. A recent plethora of studies about the biological role of METTL3 and other components of the methyltransferase complex that erase (FTO) or recognize (YTH proteins) this modification on transcripts revealed that this RNA modification plays a variety of roles in many biological processes like neurogenesis. Our work in Drosophila shows that the ancient and evolutionarily conserved gene profilin (chic in Drosophila) is a target of the m6A writer. Here, we discuss the implications of our study in Drosophila and how it unveils a conserved mechanism in support of the essential function of METTL3 in metazoan development. Profilin (chic) is an essential gene of ancient evolutionary origins, present in sponges (Porifera), the oldest still extant metazoan phylum of the common metazoan ancestor Urmetazoa. We propose that the relationship between profilin and METTL3 is conserved in metazoans and it provides insights into possible regulatory roles of m6A modification of profilin transcripts in processes such as neurogenesis.

Keywords: IME4; RNA processing alterations; alternative splicing; m6A effector; profiling.

Figures

Figure 1
Figure 1
Profilin transcripts have multiple Mettl3 binding sites. PFN1 mRNA, depicted in cartoon form at the top, has Mettl3 binding sites (AAACC) depicted by black boxes in the 3′UTR and 5′UTR. PFN2 mRNA represented as the transcript in the middle of this figure, has Mettl3 binding sites (AAACA) in the 3′UTR, exon 3, intron 1, and intron 2. PFN2 mRNA has additional binding sites in 3′UTR represented by green box (UGUGGACU). chic (Drosophila profilin), depicted as the bottom cartoon in this figure, has a cluster of METTL3 binding sites (GTTCTTATTTCTCCGCCGCTGACGGTG) in intron 3 represented by red box. This cluster, when run through appropriate algorithms, can generate hairpins for complex recognition.
Figure 2
Figure 2
Working model for profilin regulation in the brain. Profilin pre-mRNA is methylated by Mettl3 upon binding site recognition aided by Mettl14/16 and other components of the methyltransferase complex. The m6A mark is recognized by the m6A reader FMRP (dFMRP). The marking and its recognition are required for the recruitment of splicing and processing factors. Failure to properly mark and recognize profilin pre-mRNA has deleterious consequences in brain development.

Similar articles

See all similar articles

References

    1. Angelova M. T., Dimitrova D. G., Dinges N., Lence T., Worpenberg L., Carré C., et al. (2018). The emerging field of epitranscriptomics in neurodevelopmental and neuronal disorders. Front. Bioeng. Biotechnol. 6 (46), 1–15. 10.3389/fbioe.2018.00046 - DOI - PMC - PubMed
    1. Cao G., Li H. B., Yin Z., Flavell R. A. (2016). Recent advances in dynamic m6A RNA modification. Open Biol. 6 (4), 16003. 10.1098/rsob.160003 - DOI - PMC - PubMed
    1. Chandola U., Das R., Panda B. (2015). Role of the N 6-methyladenosine RNA mark in gene regulation and its implications on development and disease. Brief Funct. Genomics 14 (3), 169–179. 10.1093/bfgp/elu039 - DOI - PubMed
    1. Clancy M. J., Shambaugh M. E., Timpte C. S., Bokar J. A. (2002). Induction of sporulation in Saccharomyces cerevisiae leads to the formation of N 6-methyladenosine in mRNA: a potential mechanism for the activity of the IME4 gene. Nucleic Acids Res. 30 (20), 4509–4518. 10.1093/nar/gkf573 - DOI - PMC - PubMed
    1. Covelo-Molares H., Bartosovic M., Vanacova S. (2018). RNA methylation in nuclear pre-mRNA processing. Wiley Interdiscip. Rev. RNA 9 (6), e1489. 10.1002/wrna.1489 - DOI - PMC - PubMed

LinkOut - more resources

Feedback