Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Review
. 2020 Feb;29(2):136-148.
doi: 10.1111/exd.14068. Epub 2020 Jan 10.

The Importance of Caveolins and Caveolae to Dermatology: Lessons From the Caves and Beyond

Affiliations
Free PMC article
Review

The Importance of Caveolins and Caveolae to Dermatology: Lessons From the Caves and Beyond

Andjela N Egger et al. Exp Dermatol. .
Free PMC article

Erratum in

  • Corrigendum.
    Exp Dermatol. 2020 Apr;29(4):446. doi: 10.1111/exd.14094. Exp Dermatol. 2020. PMID: 32291800 No abstract available.

Abstract

Caveolae are flask-shaped invaginations of the cell membrane rich in cholesterol and sphingomyelin, with caveolin proteins acting as their primary structural components that allow compartmentalization and orchestration of various signalling molecules. In this review, we discuss how pleiotropic functions of caveolin-1 (Cav1) and its intricate roles in numerous cellular functions including lipid trafficking, signalling, cell migration and proliferation, as well as cellular senescence, infection and inflammation, are integral for normal development and functioning of skin and its appendages. We then examine how disruption of the homeostatic levels of Cav1 can lead to development of various cutaneous pathophysiologies including skin cancers, cutaneous fibroses, psoriasis, alopecia, age-related changes in skin and aberrant wound healing and propose how levels of Cav1 may have theragnostic value in skin physiology/pathophysiology.

Keywords: caveolae; caveolin-1; fibrosis; melanoma; psoriasis; squamous cell carcinoma; wound healing.

Conflict of interest statement

The authors declare no competing conflicts of interest.

Figures

Figure 1
Figure 1
Elevated expression of Cav1 in chronologically aged skin. Levels of Cav1 from 4 young (<50 years of age) and 4 elderly (>60 years of age) female abdominal skin (Fab) skin were assessed by qRT‐PCR (A), Western blotting (B) with Arpc2 and β‐actin serving as normalizing and loading controls, respectively. Briefly, sex‐matched skin (N = 8) from patients undergoing routine reduction surgeries (abdominoplasties), composed of both dermis and epidermis, was used to assess Cav1 levels which were determined by qRT‐PCR and Western, blotting, respectively (Arpc2 forward primer (5'‐TCCGGGACTACCTGCACTAC‐3') and reverse primer (5'‐GGTTCAGCACCTTGAGGAAG‐3'); Cav1 forward primer (5'‐GCGACCCTAAACACCTCAAC −3') and reverse primer (5'‐ATGCCGTCAAAACTGTGTGTC‐3'). Protein levels were validated by immunoperoxidase staining using Cav1 antibody (Sigma HPA049326) in chronologically aged skin. Expression of Cav1 was found to positively correlate with increasing age (Pearson's correlation coefficient r(6)=0.7509, P=.031). Error bars correspond to standard deviation from 4 biological samples from each category. **P < .01 (Student's t test). (C). Immunoperoxidase staining of representative young (42‐year‐old) and elderly (68‐year‐old) skin was used to validate upregulation of Cav1 in chronologically aged skin. Control healthy human skin specimens were obtained as discarded tissue from reduction surgery procedures in accordance to institutional approvals. Specifically, protocol to obtain unidentified skin specimens was submitted to University of Miami Human Subject Research Office (HSRO). Upon review conducted by University of Miami Institutional Review Board (IRB), it was determined that such protocol does not constitute Human Subject Research per 45 CFR46.101.2
Figure 2
Figure 2
Pleiotropic Roles of Cav1 in Skin Physiology
Figure 3
Figure 3
Skin Pathophysiology associated with deregulation of homeostatic Cav1 levels. It is the fine balance of Cav1 that is key to physiologic skin structure and function, as the slight imbalance in one direction or another affects localization and activation of various key signalling molecules and can tip the scale towards one of numerous skin pathologies. On one side, upregulation of Cav1 has been implicated in skin ageing, development of non‐healing chronic wounds and, whereas downregulation has been associated with squamous cell carcinoma, basal cell carcinoma, cutaneous fibroses, psoriasis and alopecia

Similar articles

See all similar articles

References

    1. Yamada E, J. Biophys. Biochem. Cytol. 1955, 1(5), 445. - PMC - PubMed
    1. Palade G, Fine structure of blood capillaries. J. Appl. Phys. 1953, 24, 1424.
    1. Couet J, Belanger MM, Roussel E, Drolet MC, Adv. Drug. Deliv. Rev. 2001, 49(3), 223. - PubMed
    1. Park S, Glover KJ, Im W, J. Comput. Chem. 2019, 40(16), 1570. - PMC - PubMed
    1. Lisanti MP, Scherer PE, Vidugiriene J, Tang Z, Hermanowski‐Vosatka A, Tu YH, Cook RF, Sargiacomo M, J. Cell Biol. 1994, 126(1), 111. - PMC - PubMed
Feedback