Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2020 Apr 13;18(1):38.
doi: 10.1186/s12915-020-0763-0.

Ribosomal RNA Fragmentation Into Short RNAs (rRFs) Is Modulated in a Sex- And Population of Origin-Specific Manner

Affiliations
Free PMC article

Ribosomal RNA Fragmentation Into Short RNAs (rRFs) Is Modulated in a Sex- And Population of Origin-Specific Manner

Tess Cherlin et al. BMC Biol. .
Free PMC article

Abstract

Background: The advent of next generation sequencing (NGS) has allowed the discovery of short and long non-coding RNAs (ncRNAs) in an unbiased manner using reverse genetics approaches, enabling the discovery of multiple categories of ncRNAs and characterization of the way their expression is regulated. We previously showed that the identities and abundances of microRNA isoforms (isomiRs) and transfer RNA-derived fragments (tRFs) are tightly regulated, and that they depend on a person's sex and population origin, as well as on tissue type, tissue state, and disease type. Here, we characterize the regulation and distribution of fragments derived from ribosomal RNAs (rRNAs). rRNAs form a group that includes four (5S, 5.8S, 18S, 28S) rRNAs encoded by the human nuclear genome and two (12S, 16S) by the mitochondrial genome. rRNAs constitute the most abundant RNA type in eukaryotic cells.

Results: We analyzed rRNA-derived fragments (rRFs) across 434 transcriptomic datasets obtained from lymphoblastoid cell lines (LCLs) derived from healthy participants of the 1000 Genomes Project. The 434 datasets represent five human populations and both sexes. We examined each of the six rRNAs and their respective rRFs, and did so separately for each population and sex. Our analysis shows that all six rRNAs produce rRFs with unique identities, normalized abundances, and lengths. The rRFs arise from the 5'-end (5'-rRFs), the interior (i-rRFs), and the 3'-end (3'-rRFs) or straddle the 5' or 3' terminus of the parental rRNA (x-rRFs). Notably, a large number of rRFs are produced in a population-specific or sex-specific manner. Preliminary evidence suggests that rRF production is also tissue-dependent. Of note, we find that rRF production is not affected by the identity of the processing laboratory or the library preparation kit.

Conclusions: Our findings suggest that rRFs are produced in a regimented manner by currently unknown processes that are influenced by both ubiquitous as well as population-specific and sex-specific factors. The properties of rRFs mirror the previously reported properties of isomiRs and tRFs and have implications for the study of homeostasis and disease.

Keywords: 1000 Genomes Project; Ribosomal RNA; isomiRs; miRNA; microRNA; rRFs; rRNA; rRNA-derived fragments; tRFs; tRNA-derived fragments; transfer RNA.

Conflict of interest statement

The authors declare that they have no competing interests.

Figures

Fig. 1
Fig. 1
The rRF analysis pipeline reveals many unique fragments. a Workflow of the pipeline. b Table showing the number of unique rRFs that map to each rRNA and the number of rRFs per unit length, for the 434 LCL samples. The rRNAs were padded with 50 nts on each side. Note that many rRFs have abundance ≥ 10 RPM. c Distribution of the number of LCL samples (out of 434) in which a given isomiR, tRF, or rRF could be found at an abundance ≥ 10 RPM. The boxplots are grouped by genome of origin, nuclear or mitochondrial. d Boxplots show the distribution of the average abundance (in RPM) for molecules belonging to each category. Only molecules with abundance ≥ 10 RPM were considered in our subsequent analysis. Boxplots are grouped by genome of origin. c, d The width of the boxes is proportional to the number of unique molecules in each category, and the horizontal bars in each box represent the median RPM
Fig. 2
Fig. 2
Examples of rRF-producing hotspots. ac Shown are regions from 28S rRNA (a), 16S rRNA (b), and 5S rRNA (c). Each heatmap depicts the relative abundance of rRFs across all of the 434 LCL samples that map to the region of interest. Each adjacent boxplot displays the distribution of start and end positions of rRFs for the region shown in the heatmap. The heatmaps are scaled by row (sample). d Each reference rRNA (GenBank) is shown as a rectangle with solid blue contour. The solid black vertical line denotes position 1 of the reference rRNAs. Observed endpoints of x-rRFs that map immediately upstream or downstream of the reference rRNA sequences are represented by yellow boxes. Reference rRNA transcript locations that are adjacent to the nominal endpoints and did not have any rRFs mapping to them are shown with empty boxes with dashed lines. Not drawn to scale
Fig. 3
Fig. 3
Length and abundance profiles of rRFs are globally recurring and population-specific. The line graphs show the ratio (RPM of each length/total RPM) for each length rRF and each of the 6 rRNAs where the black curve represents the average length ratio across all 434 LCL samples and the gray area represents the standard deviation of the ratio. Each heatmap shows the rRF length ratios at each sequence length, separately for the male (207) and female (227) samples. The heatmaps are hierarchically clustered by row. Dark green corresponds to the least abundance (z-score of − 3), and dark magenta to the most abundance (z- score of + 3)
Fig. 4
Fig. 4
Numerous rRFs are differentially abundant by sex and population origin. a The number of instances where SAM identified an rRF as differentially abundant is shown in yellow (FDR ≤ 0.01). The number of instances where PLS-DA identified an rRF as differentially abundant is shown in green (VIP ≥ 1.5). The intersection of the two circles shows the number of comparisons where both SAM and PLS-DA found the same rRF to be differentially abundant. Also shown is the Jaccard index of the comparisons that are found to be differentially abundant by the two methods. b The Jaccard index for each rRNA is plotted against the median RPM of the iDARs. c For the iDARs, log2 fold change was plotted as a function of significance (q-value) for each of the 10 population combinations, and separately for males and females. The key at the bottom shows the q-value distribution in each of the 10 intervals that represent a population vs. population comparison
Fig. 5
Fig. 5
Independent experimentation validates the presence of rRFs in LCLs. a Boxplots show the abundance of the 5.8S 24-mer i-rRF (GGGCUACGCCUGUCUGAGCGUCGC) across the five LCL populations (434 total samples). Males are represented by gray boxes, and females are represented by orange boxes. The abundance is shown in the boxplots where there is a statistically significant difference between each population according to Welch’s t-test. b Two northern blots probing for the 5.8S 24-mer i-rRF in RNA from nine male and nine female LCLs. Three cell lines from each of CEU, GBR, and YRI were used for each sex. Each lane contains 5 μg of RNA from each sample, and the first lane in each blot has 5 pmol of 5.8S 24-mer target cDNA (lower band). Full-length 5S (ACGUCUGAUCUGAGGUCGCGU) is the top band and served as loading control. rRF bands were normalized to the 121-nt 5S loading control band. Below each blot is a quantification of the 5.8S rRF probe where CEU is represented by purple, GBR is represented by cyan, and YRI is represented by yellow
Fig. 6
Fig. 6
Preliminary evidence that the rRF profiles are tissue-dependent. Boxplots show the abundance of rRFs at each length for the 434 LCL samples, all 80 TCGA UVM samples, three replicates of 293T cells, and three replicates of 293T EV. Yellow boxes indicate the max y-axis values represented on each boxplot. The sequence that is common to all rRFs is shown underlined. Each rRF differs from its adjacent rRF by one nucleotide. a i-, 3′-, and x-rRFs produced from the 3′-end of the 5S rRNA transcript. b 5′-rRFs produced from the 28S rRNA transcript. The data values for the 5S and 28S rRFs for the three 293T cells and three 293T EV are in Additional file 4

Similar articles

See all similar articles

References

    1. Weinberg RA, Penman S. Small molecular weight monodisperse nuclear RNA. J Mol Biol. 1968;38:289–304. doi: 10.1016/0022-2836(68)90387-2. - DOI - PubMed
    1. Yu S, Lemos B. A portrait of ribosomal DNA contacts with hi-C reveals 5S and 45S rDNA anchoring points in the folded human genome. Genome Biol Evol. 2016;8:3545–3558. doi: 10.1093/gbe/evw257. - DOI - PMC - PubMed
    1. Boisvert F-M, van Koningsbruggen S, Navascués J, Lamond AI. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 2007;8:574–585. doi: 10.1038/nrm2184. - DOI - PubMed
    1. Brimacombe R, Stiege W. Structure and function of ribosomal RNA. Biochem J. 1985;229:1–17. doi: 10.1042/bj2290001. - DOI - PMC - PubMed
    1. Wilson DN, Cate JHD. The structure and function of the eukaryotic ribosome. Cold Spring Harb Perspect Biol. 2012;4:5. doi: 10.1101/cshperspect.a011536. - DOI - PMC - PubMed

LinkOut - more resources

Feedback