Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice

doi:10.1111/pbi.13427

. 2020 Dec;18(12):2385-2387.

doi: 10.1111/pbi.13427. Epub 2020 Jun 18.

Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice

Dongchang Zeng^{1

2

3}, Taoli Liu^{1

2

3}, Xingliang Ma^{1

3}, Bin Wang^{1

3}, Zhiye Zheng³, Yaling Zhang^{1

3}, Xianrong Xie^{1

2

3}, Bowen Yang^{1

3}, Zhe Zhao^{1

3}, Qinlong Zhu^{1

2

3}, Yao-Guang Liu^{1

2

3}

Affiliations

¹ State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China.
² Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China.
³ College of Life Sciences, South China Agricultural University, Guangzhou, China.

PMID: 32485068
PMCID: PMC7680535
DOI: 10.1111/pbi.13427

Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice

Dongchang Zeng et al. Plant Biotechnol J. 2020 Dec.

. 2020 Dec;18(12):2385-2387.

doi: 10.1111/pbi.13427. Epub 2020 Jun 18.

Authors

Affiliations

¹ State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China.
² Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China.
³ College of Life Sciences, South China Agricultural University, Guangzhou, China.

PMID: 32485068
PMCID: PMC7680535
DOI: 10.1111/pbi.13427

No abstract available

Keywords: Waxy; CRISPR/Cas; amylose content; genome editing; quantitative trait; rice.

PubMed Disclaimer

Conflict of interest statement

The authors declare no conflict of interest.

Figures

**Figure 1**
Improvement of rice grain quality by quantitative regulation of Wx expression via promoter and 5’UISS editing using CRISPR/Cas9. (a) Structure of *Wx^a* and target sites at the promoter region (T1–T8 in four pairs), the intronic splicing site within the 5’untranslation region (5’UISS; T9) or a coding exon (T10). F‐RT/R‐RT and F‐qRT/R‐qRT, primers for RT‐PCR and qRT‐PCR, respectively. (b) Nucleotide variations (in red) at the targets (protospacer adjacent motif in italic) of homozygous mutant lines (T₂) from an *indica* variety TFB carrying *Wx^a*. ‘‐’ and ‘del’, base deletion; ‘in’, base insertion; ‘subs’, base substitution (AGACACAAATTCCTTCAGTTCTTTGTCTATCGGGCT). Sequences between the targets are omitted. Lower‐case letters, the intron. TFBg, a glutinous line. (c, d) cDNAs (RNAs from 15‐day‐old seeds) showing mRNA splicing by sequencing 24 clones each line (c) and agarose‐gel analysis (d). Asterisks indicate spliced‐out nucleotides. KY131, a *japonica* variety with *Wx^b* having a G‐to‐T mutation at the splicing site (SS). *Actin 1*, a control. (e) Measurements of Wx expression, amylose content (AC) and gel consistency (GC). Bars, SD (n = 3). Samples without a same letter show significant difference by Duncan's test (P < 0.05). (f) Polished grains of TFB and representative edited lines. (g) Rapid visco analysis profiles of grain starches of the lines. HHZ, an *indica* variety (with *Wx^b* and 17.1% AC) as a comparison. cP (centi Poise), viscosity unit.

See this image and copyright information in PMC

Cited by

A Novel Allele in the Promoter of Wx Decreases Gene Expression and Confers Lower Apparent Amylose Contents in Japonica Rice (Oryza sativa L.).
Tang W, Chen H, Zhang S, Tang J, Lin J, Fang X, Chen G, Zhang Y. Tang W, et al. Plants (Basel). 2024 Mar 6;13(5):745. doi: 10.3390/plants13050745. Plants (Basel). 2024. PMID: 38475591 Free PMC article.
CRISPR/Cas9-mediated enhancement of semi-dwarf glutinous traits in elite Xiangdaowan rice (Oryza sativa L.): targeting SD1 and Wx genes for yield and quality improvement.
Wang Q, Gao H, Liu K, Wang H, Zhang F, Wei L, Lu K, Li M, Shi Y, Zhao J, Zhou W, Peng B, Yuan H. Wang Q, et al. Front Plant Sci. 2024 Feb 16;15:1333191. doi: 10.3389/fpls.2024.1333191. eCollection 2024. Front Plant Sci. 2024. PMID: 38434426 Free PMC article.
Application of genome editing techniques to regulate gene expression in crops.
Dong H. Dong H. BMC Plant Biol. 2024 Feb 9;24(1):100. doi: 10.1186/s12870-024-04786-2. BMC Plant Biol. 2024. PMID: 38331711 Free PMC article. Review.
Effect of Fat Content on Rice Taste Quality through Transcriptome Analysis.
Guo J, Zhou X, Chen D, Chen K, Ye C, Liu J, Liu S, Chen Y, Chen G, Liu C. Guo J, et al. Genes (Basel). 2024 Jan 9;15(1):81. doi: 10.3390/genes15010081. Genes (Basel). 2024. PMID: 38254970 Free PMC article.
OsCIPK9 Interacts with OsSOS3 and Affects Salt-Related Transport to Improve Salt Tolerance.
Zhou Z, Tang W, Sun Z, Li J, Yang B, Liu Y, Wang B, Xu D, Yang J, Zhang Y. Zhou Z, et al. Plants (Basel). 2023 Oct 30;12(21):3723. doi: 10.3390/plants12213723. Plants (Basel). 2023. PMID: 37960079 Free PMC article.

See all "Cited by" articles

References

1. Fitzgerald, M. , Martin, M. , Ward, R. , Park, W. and Shead, H. (2003) Viscosity of rice flour: A rheological and biological study. J Agric Food Chem. 51, 2295–2299. - PubMed
1. Isshiki, M. , Morino, K. , Nakajima, M. , Okagaki, R. , Wessler, S. , Izawa, T. and Shimamoto, K. (1998) A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 15, 133–138. - PubMed
1. Li, X. , Xie, Y. , Zhu, Q. and Liu, Y. (2017) Targeted genome editing in genes and cis‐ regulatory regions improves qualitative and quantitative traits in crops. Mol. Plant, 10, 1368–1370. - PubMed
1. Li, Z. , Xiong, X. , Wang, F. , Liang, J. and Li, J.F. (2019) Gene disruption through base editing‐induced messenger RNA missplicing in plants. New Phytol. 222, 1139–1148. - PubMed
1. Ma, X. , Zhang, Q. , Zhu, Q. , Liu, W. , Chen, Y. , Qiu, R. , Wang, B. et al (2015) A robust CRISPR/Cas9 system for convenient, high‐efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant, 8, 1274–1284. - PubMed

Publication types

Actions

MeSH terms

Actions
Actions
Actions
Actions
Actions
Actions

Substances

Actions
Actions

LinkOut - more resources

Full Text Sources

[1] Fitzgerald, M. , Martin, M. , Ward, R. , Park, W. and Shead, H. (2003) Viscosity of rice flour: A rheological and biological study. J Agric Food Chem. 51, 2295–2299. - PubMed

[2] Fitzgerald, M. , Martin, M. , Ward, R. , Park, W. and Shead, H. (2003) Viscosity of rice flour: A rheological and biological study. J Agric Food Chem. 51, 2295–2299. - PubMed

[3] Isshiki, M. , Morino, K. , Nakajima, M. , Okagaki, R. , Wessler, S. , Izawa, T. and Shimamoto, K. (1998) A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 15, 133–138. - PubMed

[4] Isshiki, M. , Morino, K. , Nakajima, M. , Okagaki, R. , Wessler, S. , Izawa, T. and Shimamoto, K. (1998) A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 15, 133–138. - PubMed

[5] Li, X. , Xie, Y. , Zhu, Q. and Liu, Y. (2017) Targeted genome editing in genes and cis‐ regulatory regions improves qualitative and quantitative traits in crops. Mol. Plant, 10, 1368–1370. - PubMed

[6] Li, X. , Xie, Y. , Zhu, Q. and Liu, Y. (2017) Targeted genome editing in genes and cis‐ regulatory regions improves qualitative and quantitative traits in crops. Mol. Plant, 10, 1368–1370. - PubMed

[7] Li, Z. , Xiong, X. , Wang, F. , Liang, J. and Li, J.F. (2019) Gene disruption through base editing‐induced messenger RNA missplicing in plants. New Phytol. 222, 1139–1148. - PubMed

[8] Li, Z. , Xiong, X. , Wang, F. , Liang, J. and Li, J.F. (2019) Gene disruption through base editing‐induced messenger RNA missplicing in plants. New Phytol. 222, 1139–1148. - PubMed

[9] Ma, X. , Zhang, Q. , Zhu, Q. , Liu, W. , Chen, Y. , Qiu, R. , Wang, B. et al (2015) A robust CRISPR/Cas9 system for convenient, high‐efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant, 8, 1274–1284. - PubMed

[10] Ma, X. , Zhang, Q. , Zhu, Q. , Liu, W. , Chen, Y. , Qiu, R. , Wang, B. et al (2015) A robust CRISPR/Cas9 system for convenient, high‐efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant, 8, 1274–1284. - PubMed

Save citation to file

Email citation

Add to Collections

Add to My Bibliography

Your saved search

Create a file for external citation management software

Your RSS Feed

Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice

Affiliations

Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice

Authors

Affiliations

Conflict of interest statement

Figures

Similar articles

Cited by

References

Publication types

MeSH terms

Substances

LinkOut - more resources

Full Text Sources

Conflict of interest statement

Figures

Similar articles

Cited by

References

Publication types

MeSH terms

Substances

Related information

LinkOut - more resources

Full Text Sources