Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

J Biol Chem. 1996 Mar 15;271(11):6379-88. doi: 10.1074/jbc.271.11.6379.

Abstract

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Publication types

  • Research Support, Non-U.S. Gov't

MeSH terms

  • Androgens / pharmacology*
  • Animals
  • Base Sequence
  • Binding Sites / genetics
  • Cell Line
  • Chromosome Mapping
  • Consensus Sequence
  • DNA / genetics
  • Dexamethasone / pharmacology
  • Humans
  • Male
  • Molecular Sequence Data
  • Mutation
  • Promoter Regions, Genetic / drug effects*
  • Prostate-Specific Antigen / genetics*
  • Rats
  • Receptors, Androgen / genetics
  • Receptors, Glucocorticoid / genetics
  • Sequence Deletion
  • Steroids / pharmacology*
  • Thymidine Kinase / genetics

Substances

  • Androgens
  • Receptors, Androgen
  • Receptors, Glucocorticoid
  • Steroids
  • Dexamethasone
  • DNA
  • Thymidine Kinase
  • Prostate-Specific Antigen

Associated data

  • GENBANK/X92553