Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My Custom Filters

Results by year

Table representation of search results timeline featuring number of search results per year.

Year Number of Results
2010 1
2012 1
2013 2
2014 4
2015 1
2016 1
2018 4
2019 2
2020 4
2021 11
2022 6
2023 8
2024 5
2025 3
2026 0

Publication date

Text availability

Article attribute

Article type

Additional filters

Article Language

Species

Sex

Age

Other

Search Results

45 results

Results by year

Filters applied: . Clear all
Page 1
Nanostructures in non-invasive prenatal genetic screening.
Sadeghi S, Rahaie M, Ostad-Hasanzadeh B. Sadeghi S, et al. Biomed Eng Lett. 2021 Oct 11;12(1):3-18. doi: 10.1007/s13534-021-00208-6. eCollection 2022 Feb. Biomed Eng Lett. 2021. PMID: 35186357 Free PMC article. Review.
Trends and frontiers in signal amplification for aptamer-based tumor detection: A bibliometric analysis.
Cai D, Chen GL, Wang T, Zhang KH. Cai D, et al. World J Clin Cases. 2024 Jul 26;12(21):4726-4741. doi: 10.12998/wjcc.v12.i21.4726. World J Clin Cases. 2024. PMID: 39070802 Free PMC article.
The most influential authors and journals were Hasanzadeh M. from Iran and "Biosensors and Bioelectronics", respectively. Exosomes and carcinoembryonic antigen (CEA) stood out as the most researched tumor-related molecules. ...
The most influential authors and journals were Hasanzadeh M. from Iran and "Biosensors and Bioelectronics", respectively. Exos …
Objective measurement of children's physical activity geographies: A systematic search and scoping review.
Smith M, Cui J, Ikeda E, Mavoa S, Hasanzadeh K, Zhao J, Rinne TE, Donnellan N, Kyttä M. Smith M, et al. Health Place. 2021 Jan;67:102489. doi: 10.1016/j.healthplace.2020.102489. Epub 2020 Dec 7. Health Place. 2021. PMID: 33302122 Free PMC article.
The majority of studies estimated children's environments using Euclidean or network buffers ranging from 100 m to 5 km. No singular approach to measuring children's physical activity geographies was identified as optimal. ...
The majority of studies estimated children's environments using Euclidean or network buffers ranging from 100 m to 5 km. No singular …
Sub-micro electrochemical recognition of carmoisine, sunset yellow, and tartrazine in fruit juices using P(β-CD/Arg)/CysA-AuNPs/AuE.
Ahmadi S, Hasanzadeh M, Ghasempour Z. Ahmadi S, et al. Food Chem. 2023 Feb 15;402:134501. doi: 10.1016/j.foodchem.2022.134501. Epub 2022 Oct 3. Food Chem. 2023. PMID: 36303391
For three azo dyes (carmoisine, sunset yellow, and tartrazine), the analytical linear range was 10(-)(8) to 10(-)(4) M, with a low limit of quantification of about 1 nM. The engineered chemosensor showed suitable selectivity for analyzing candidate dyes in the presence of …
For three azo dyes (carmoisine, sunset yellow, and tartrazine), the analytical linear range was 10(-)(8) to 10(-)(4) M, with a low li …
Targeted delivery of liposomal Ribociclib to SLC7A5 transporters in breast cancer cells.
Afsharzadeh M, Varshosaz J, Mirian M, Hasanzadeh F. Afsharzadeh M, et al. Invest New Drugs. 2024 Feb;42(1):89-105. doi: 10.1007/s10637-023-01409-9. Epub 2023 Dec 21. Invest New Drugs. 2024. PMID: 38127209
Targeted liposomes reduced cell cycle with more interruption in the G2/M phase compared to the negative control....
Targeted liposomes reduced cell cycle with more interruption in the G2/M phase compared to the negative control....
Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis.
Adampourezare M, Dehghan G, Hasanzadeh M, Feizi MH. Adampourezare M, et al. J Mol Recognit. 2021 Dec;34(12):e2938. doi: 10.1002/jmr.2938. Epub 2021 Oct 6. J Mol Recognit. 2021. PMID: 34612542
Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer). ...Also, some of the mismatch sequences {(GC(M …
Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAA …
Differentiation of human endometrial stem cells encapsulated in alginate hydrogel into oocyte-like cells.
Ghasemi D, Ebrahimi-Barough S, Nekoofar MH, Mohamadnia A, Lotfibakhshaiesh N, Bahrami N, Karimi R, Taghdiri Nooshabadi V, Azami M, Hasanzadeh E, Ai J. Ghasemi D, et al. Bioimpacts. 2023;13(3):229-240. doi: 10.34172/bi.2022.23960. Epub 2022 Dec 4. Bioimpacts. 2023. PMID: 37431484 Free PMC article.
RESULTS: Our results from microscopy analysis, real-time PCR, and immunofluorescence tests revealed that 10 M RA concentration was the optimal dose for inducing germ-like cells after 7 days. We examined the alginate hydrogel structural characteristics and integrity by rheo …
RESULTS: Our results from microscopy analysis, real-time PCR, and immunofluorescence tests revealed that 10 M RA concentration was th …
Deoxynivalenol reduces quality parameters and increases DNA damage in mice spermatozoa.
Hallaj Salahipour M, Hasanzadeh S, Malekinejad H, Razi M, Farrokhi-Ardebili F. Hallaj Salahipour M, et al. Andrologia. 2019 Jun;51(5):e13238. doi: 10.1111/and.13238. Epub 2019 Jan 31. Andrologia. 2019. PMID: 30706512
Mice spermatozoa were exposed to DON at 0, 2.5, 5 and 10 M for 1, 3 and 6 hr, motility parameters were evaluated by computer-assisted analysis and viability was examined by colorimetric metabolic activity assay and HOS test. ...In comparison with the controls, after 1, 3 a …
Mice spermatozoa were exposed to DON at 0, 2.5, 5 and 10 M for 1, 3 and 6 hr, motility parameters were evaluated by computer-assisted …
Low-level Eexposure to lead dust in unusual work schedules and hematologic, renal, and hepatic parameters.
Kooshki F, Neghab M, Soleimani E, Hasanzadeh J. Kooshki F, et al. Toxicol Appl Pharmacol. 2021 Mar 15;415:115448. doi: 10.1016/j.taap.2021.115448. Epub 2021 Feb 9. Toxicol Appl Pharmacol. 2021. PMID: 33577916
RESULTS: The TWA exposure of workers was 24 mug/m(3). On average, the worker's exposure to lead dust did not exceed the 8-h OSHA and ACGIH TLV-TWA of 50 mug/m(3). ...
RESULTS: The TWA exposure of workers was 24 mug/m(3). On average, the worker's exposure to lead dust did not exceed the 8-h OSHA and …
45 results