ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.