Yeast deRNA viral transcriptase pause products: identification of the transcript strand

Nucleic Acids Res. 1981 Oct 10;9(19):5049-59. doi: 10.1093/nar/9.19.5049.

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

Publication types

  • Research Support, U.S. Gov't, P.H.S.

MeSH terms

  • DNA-Directed RNA Polymerases / metabolism*
  • RNA, Double-Stranded / metabolism*
  • RNA, Viral / metabolism*
  • Saccharomyces cerevisiae / genetics*
  • Transcription, Genetic*

Substances

  • RNA, Double-Stranded
  • RNA, Viral
  • DNA-Directed RNA Polymerases